ID: 993413964

View in Genome Browser
Species Human (GRCh38)
Location 5:87602456-87602478
Sequence AAGGGTTGCAAAGATCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993413957_993413964 14 Left 993413957 5:87602419-87602441 CCTGGTGGAGTGGGTTCACAAAG No data
Right 993413964 5:87602456-87602478 AAGGGTTGCAAAGATCCTGTGGG No data
993413956_993413964 15 Left 993413956 5:87602418-87602440 CCCTGGTGGAGTGGGTTCACAAA No data
Right 993413964 5:87602456-87602478 AAGGGTTGCAAAGATCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993413964 Original CRISPR AAGGGTTGCAAAGATCCTGT GGG Intergenic
No off target data available for this crispr