ID: 993430533

View in Genome Browser
Species Human (GRCh38)
Location 5:87827168-87827190
Sequence CAGTTCAAGGTGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993430528_993430533 -4 Left 993430528 5:87827149-87827171 CCAAGAAGGAAAAGTCTTGCAGT No data
Right 993430533 5:87827168-87827190 CAGTTCAAGGTGAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993430533 Original CRISPR CAGTTCAAGGTGAGGGAGGC AGG Intergenic
No off target data available for this crispr