ID: 993431240

View in Genome Browser
Species Human (GRCh38)
Location 5:87834252-87834274
Sequence TTCAGGCAACGTTCTACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993431234_993431240 10 Left 993431234 5:87834219-87834241 CCAAAAACATTAGATCAAAGAGG No data
Right 993431240 5:87834252-87834274 TTCAGGCAACGTTCTACTGGGGG No data
993431232_993431240 22 Left 993431232 5:87834207-87834229 CCTCAAAATCTCCCAAAAACATT No data
Right 993431240 5:87834252-87834274 TTCAGGCAACGTTCTACTGGGGG No data
993431233_993431240 11 Left 993431233 5:87834218-87834240 CCCAAAAACATTAGATCAAAGAG No data
Right 993431240 5:87834252-87834274 TTCAGGCAACGTTCTACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993431240 Original CRISPR TTCAGGCAACGTTCTACTGG GGG Intergenic
No off target data available for this crispr