ID: 993443208

View in Genome Browser
Species Human (GRCh38)
Location 5:87980589-87980611
Sequence CAATTTCTGCAAAGGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993443204_993443208 -10 Left 993443204 5:87980576-87980598 CCCAGCTTCACAACAATTTCTGC No data
Right 993443208 5:87980589-87980611 CAATTTCTGCAAAGGAAGGATGG No data
993443203_993443208 12 Left 993443203 5:87980554-87980576 CCTGGAAATGAAGCATAGAGGGC No data
Right 993443208 5:87980589-87980611 CAATTTCTGCAAAGGAAGGATGG No data
993443200_993443208 29 Left 993443200 5:87980537-87980559 CCTAGGAGAGTGGGATGCCTGGA No data
Right 993443208 5:87980589-87980611 CAATTTCTGCAAAGGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993443208 Original CRISPR CAATTTCTGCAAAGGAAGGA TGG Intergenic
No off target data available for this crispr