ID: 993449808

View in Genome Browser
Species Human (GRCh38)
Location 5:88059706-88059728
Sequence TCATCTCAATTCAGGCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993449808_993449816 6 Left 993449808 5:88059706-88059728 CCCTCAGGCCTGAATTGAGATGA No data
Right 993449816 5:88059735-88059757 CCATACTGGTTGTGTACCCTGGG No data
993449808_993449813 -8 Left 993449808 5:88059706-88059728 CCCTCAGGCCTGAATTGAGATGA No data
Right 993449813 5:88059721-88059743 TGAGATGATGGGCACCATACTGG No data
993449808_993449817 9 Left 993449808 5:88059706-88059728 CCCTCAGGCCTGAATTGAGATGA No data
Right 993449817 5:88059738-88059760 TACTGGTTGTGTACCCTGGGTGG No data
993449808_993449814 5 Left 993449808 5:88059706-88059728 CCCTCAGGCCTGAATTGAGATGA No data
Right 993449814 5:88059734-88059756 ACCATACTGGTTGTGTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993449808 Original CRISPR TCATCTCAATTCAGGCCTGA GGG (reversed) Intergenic