ID: 993452387

View in Genome Browser
Species Human (GRCh38)
Location 5:88088303-88088325
Sequence TCAATTGTGTTTACAGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993452387_993452390 -9 Left 993452387 5:88088303-88088325 CCTCCAGCTGTAAACACAATTGA No data
Right 993452390 5:88088317-88088339 CACAATTGAAACTAACTCCAGGG No data
993452387_993452389 -10 Left 993452387 5:88088303-88088325 CCTCCAGCTGTAAACACAATTGA No data
Right 993452389 5:88088316-88088338 ACACAATTGAAACTAACTCCAGG No data
993452387_993452392 24 Left 993452387 5:88088303-88088325 CCTCCAGCTGTAAACACAATTGA No data
Right 993452392 5:88088350-88088372 TATGAAAGACCAAAGTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993452387 Original CRISPR TCAATTGTGTTTACAGCTGG AGG (reversed) Intergenic
No off target data available for this crispr