ID: 993454584

View in Genome Browser
Species Human (GRCh38)
Location 5:88112978-88113000
Sequence GGTGTCATGAGTACAAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993454580_993454584 28 Left 993454580 5:88112927-88112949 CCACAAACACAGTGGCTTAAAAC 0: 9
1: 88
2: 554
3: 1905
4: 5027
Right 993454584 5:88112978-88113000 GGTGTCATGAGTACAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993454584 Original CRISPR GGTGTCATGAGTACAAAATA AGG Intergenic
No off target data available for this crispr