ID: 993462728

View in Genome Browser
Species Human (GRCh38)
Location 5:88204412-88204434
Sequence ACATTTAAAGCATTTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2673
Summary {0: 1, 1: 0, 2: 2, 3: 110, 4: 2560}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993462728_993462732 12 Left 993462728 5:88204412-88204434 CCACCACCAAATGCTTTAAATGT 0: 1
1: 0
2: 2
3: 110
4: 2560
Right 993462732 5:88204447-88204469 ATTCTTTCATCCCACAGACTGGG 0: 1
1: 0
2: 0
3: 21
4: 224
993462728_993462735 23 Left 993462728 5:88204412-88204434 CCACCACCAAATGCTTTAAATGT 0: 1
1: 0
2: 2
3: 110
4: 2560
Right 993462735 5:88204458-88204480 CCACAGACTGGGTAAACCATCGG 0: 1
1: 0
2: 0
3: 7
4: 93
993462728_993462737 30 Left 993462728 5:88204412-88204434 CCACCACCAAATGCTTTAAATGT 0: 1
1: 0
2: 2
3: 110
4: 2560
Right 993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG 0: 1
1: 0
2: 0
3: 2
4: 63
993462728_993462731 11 Left 993462728 5:88204412-88204434 CCACCACCAAATGCTTTAAATGT 0: 1
1: 0
2: 2
3: 110
4: 2560
Right 993462731 5:88204446-88204468 GATTCTTTCATCCCACAGACTGG 0: 1
1: 0
2: 1
3: 8
4: 166
993462728_993462736 29 Left 993462728 5:88204412-88204434 CCACCACCAAATGCTTTAAATGT 0: 1
1: 0
2: 2
3: 110
4: 2560
Right 993462736 5:88204464-88204486 ACTGGGTAAACCATCGGATGTGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993462728 Original CRISPR ACATTTAAAGCATTTGGTGG TGG (reversed) Intronic
Too many off-targets to display for this crispr