ID: 993462729

View in Genome Browser
Species Human (GRCh38)
Location 5:88204415-88204437
Sequence AAAACATTTAAAGCATTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 529}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993462729_993462738 28 Left 993462729 5:88204415-88204437 CCACCAAATGCTTTAAATGTTTT 0: 1
1: 0
2: 3
3: 65
4: 529
Right 993462738 5:88204466-88204488 TGGGTAAACCATCGGATGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 69
993462729_993462737 27 Left 993462729 5:88204415-88204437 CCACCAAATGCTTTAAATGTTTT 0: 1
1: 0
2: 3
3: 65
4: 529
Right 993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG 0: 1
1: 0
2: 0
3: 2
4: 63
993462729_993462736 26 Left 993462729 5:88204415-88204437 CCACCAAATGCTTTAAATGTTTT 0: 1
1: 0
2: 3
3: 65
4: 529
Right 993462736 5:88204464-88204486 ACTGGGTAAACCATCGGATGTGG 0: 1
1: 0
2: 0
3: 3
4: 50
993462729_993462735 20 Left 993462729 5:88204415-88204437 CCACCAAATGCTTTAAATGTTTT 0: 1
1: 0
2: 3
3: 65
4: 529
Right 993462735 5:88204458-88204480 CCACAGACTGGGTAAACCATCGG 0: 1
1: 0
2: 0
3: 7
4: 93
993462729_993462731 8 Left 993462729 5:88204415-88204437 CCACCAAATGCTTTAAATGTTTT 0: 1
1: 0
2: 3
3: 65
4: 529
Right 993462731 5:88204446-88204468 GATTCTTTCATCCCACAGACTGG 0: 1
1: 0
2: 1
3: 8
4: 166
993462729_993462732 9 Left 993462729 5:88204415-88204437 CCACCAAATGCTTTAAATGTTTT 0: 1
1: 0
2: 3
3: 65
4: 529
Right 993462732 5:88204447-88204469 ATTCTTTCATCCCACAGACTGGG 0: 1
1: 0
2: 0
3: 21
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993462729 Original CRISPR AAAACATTTAAAGCATTTGG TGG (reversed) Intronic
901160793 1:7175496-7175518 ACAACACATAGAGCATTTGGCGG - Intronic
901552547 1:10006347-10006369 AAAATATTTAAAACATTTCCAGG + Intronic
903437666 1:23363878-23363900 AAAAAATTTAAAAAATTAGGTGG + Intronic
903565710 1:24263957-24263979 AAAACCTTCAAAATATTTGGAGG + Intergenic
903913190 1:26743797-26743819 AAAAAAATTAAAACATTTGAAGG + Intronic
904084409 1:27894820-27894842 AGAGCATTTTAAGAATTTGGTGG - Intronic
904524929 1:31126094-31126116 AAAATGTTTAAAGTATTAGGAGG - Intergenic
904664959 1:32113229-32113251 AAAACATTTAAAAAATTAGCTGG + Intronic
904806170 1:33133922-33133944 AAGGCATGTAAAGCATCTGGTGG - Intergenic
905153288 1:35950271-35950293 AAAACATTTAAGTCACTTAGAGG - Intronic
906517727 1:46449352-46449374 AAAAAATTTAAAAAATTAGGAGG - Intergenic
906994966 1:50782679-50782701 AAAACTTTTAAAACTTTTTGAGG - Intronic
907345731 1:53778035-53778057 AAAAGATGTAAATCTTTTGGTGG + Intronic
907690623 1:56661184-56661206 AAAACGTTAAGAACATTTGGAGG - Intronic
908128534 1:61052691-61052713 AAATCATTAAAAGTATTTTGTGG - Intronic
908383760 1:63620805-63620827 ATTACATTTAAACCATATGGGGG - Intronic
908606305 1:65800646-65800668 AAAACATTTGAAACAATTTGTGG + Intronic
908982708 1:69978039-69978061 AAAACAAAAAAAGCATTGGGAGG + Intronic
909069572 1:70978170-70978192 AAACCAATTATAGAATTTGGAGG - Intronic
909400741 1:75226991-75227013 AAAACATTTAAACCACTTATAGG - Intronic
909572291 1:77129048-77129070 TAAATATTTAAAGCATTTGTAGG - Intronic
910647478 1:89529261-89529283 AAAATATTAATAGGATTTGGGGG - Intronic
911086673 1:93984189-93984211 AAAACATGGAAAGGATCTGGTGG - Intergenic
911201503 1:95049231-95049253 TAAACATTTAAAAAATATGGGGG + Intronic
911266251 1:95747581-95747603 AAAGCAATTAAAGCAGTTGTAGG - Intergenic
911320440 1:96407733-96407755 ACAAAATTAAAAGGATTTGGTGG - Intergenic
911330229 1:96518474-96518496 AAAATATTTAAAGAATTAGCAGG + Intergenic
912302574 1:108533358-108533380 AATGCATTTAAAGCACTTAGAGG - Intergenic
913125018 1:115778662-115778684 AAAACATTTAAAAAATTAGCCGG + Intergenic
914505384 1:148284603-148284625 CAAAGATATAAAGCATTTCGAGG - Intergenic
914507178 1:148299548-148299570 CAAAGATATAAAGCATTTCGAGG + Intergenic
914557590 1:148782578-148782600 AAAAAATTTAAAACATAAGGAGG + Intergenic
914615244 1:149347652-149347674 AAAAAATTTAAAACATAAGGAGG - Intergenic
915214766 1:154332564-154332586 AAAACATTTAGAGGATGAGGAGG + Intronic
915678902 1:157560622-157560644 AAAAAAATTGAAGAATTTGGTGG - Intergenic
916024402 1:160821291-160821313 GAAACTTTTAATGCATTTGCAGG + Intronic
916474602 1:165156946-165156968 AATACATTAATAACATTTGGTGG - Intergenic
917053176 1:170948361-170948383 AAAACATTGATATCATTTGGTGG + Intronic
917779429 1:178376478-178376500 AAAACATTTTATGGGTTTGGAGG + Intronic
917949135 1:180011296-180011318 AGAACATGTAAAAAATTTGGAGG - Intronic
919638399 1:200025941-200025963 AAAACATTTAAAAAATTAGCTGG + Intergenic
919719014 1:200811599-200811621 AAAATATATAAAGCATCTGTTGG - Intronic
919886861 1:201941255-201941277 ATAATATTTAAAGAATTTTGAGG - Intronic
920606677 1:207395662-207395684 AAAACAGTTGAAGTATTTGGGGG + Intergenic
921139279 1:212290519-212290541 AAAAAATTTAAAACATTTTTAGG + Intronic
921183374 1:212649506-212649528 AAAACATCTGAAGCAGTTGTTGG + Intergenic
921588181 1:216973191-216973213 AAACCATTTATAGGATTTTGAGG - Intronic
921809430 1:219495956-219495978 AAAACATATTAAATATTTGGTGG + Intergenic
921863758 1:220066973-220066995 AAAATATATAATGCATTTAGTGG + Intronic
923151585 1:231238190-231238212 AAAAAATTAAAAACATTTGGAGG + Intronic
923605811 1:235441443-235441465 AAAACATTTGAAGTATTTGAAGG + Intronic
923794805 1:237143440-237143462 AAAGCAGCTACAGCATTTGGAGG - Intronic
923896791 1:238278846-238278868 AAAATATTTAAAGCAATCTGAGG - Intergenic
923969366 1:239182356-239182378 AAAACATGTAAATCATTAGCAGG + Intergenic
924594404 1:245432636-245432658 GAAGTATGTAAAGCATTTGGGGG + Intronic
924615690 1:245609744-245609766 ACCACAATTACAGCATTTGGGGG + Intronic
924948942 1:248865179-248865201 AAAAGATTTAAAGAATTTGCTGG - Intergenic
1064614773 10:17141458-17141480 AAAACCTTAAAAGCAGCTGGAGG - Intergenic
1064728378 10:18304106-18304128 AAAACATTAGAAGGATGTGGGGG - Intronic
1065449516 10:25842262-25842284 CCAACAATTAAAGCATTTCGAGG + Intergenic
1065654419 10:27933095-27933117 AAAAAATTTAAAGAATTAGAGGG + Intronic
1066142849 10:32525695-32525717 AAGACTTTTAAAGTATTTGAAGG + Intronic
1066168260 10:32812654-32812676 AAAAGATTTAAAGCAAAGGGAGG + Intronic
1066334424 10:34461927-34461949 AAAATATTTAAAGCATATGAAGG + Intronic
1066824047 10:39540239-39540261 TGGACATTTGAAGCATTTGGAGG + Intergenic
1067614312 10:47748556-47748578 AAAACATTAAAAGCAGCTAGAGG + Intergenic
1067939742 10:50644490-50644512 AAACCAATTAAAACCTTTGGAGG + Intergenic
1068582877 10:58762402-58762424 AAAATATCTAAAGCATATAGTGG + Intronic
1068619941 10:59170996-59171018 GAAAAATTGAAAGCTTTTGGTGG - Intergenic
1068968290 10:62935745-62935767 AAAACATTCTCAGCATTTGAGGG - Intergenic
1069153742 10:64999131-64999153 AAAACTTTCACAGCATTTTGTGG + Intergenic
1070065654 10:73031321-73031343 AAAACATTTAAAAAATTAGCTGG + Intronic
1070185262 10:74056261-74056283 AAAACATTCAAAACATTTCAAGG - Intronic
1070276146 10:75009395-75009417 AAACCATTTCAAGCCTTTGCAGG + Intronic
1070340346 10:75492683-75492705 AAAATAATAAAAGCATTAGGGGG - Intronic
1070373971 10:75811113-75811135 AATACATTTAAAATATTTGGTGG + Intronic
1070792823 10:79199848-79199870 ACATCCTTTAAAGCAATTGGAGG + Intronic
1071077101 10:81768188-81768210 AAGACATTGCAATCATTTGGAGG + Intergenic
1071629722 10:87208534-87208556 AAAACATTAAAAGCAGCTAGAGG + Intergenic
1072339695 10:94434743-94434765 AAAACATTTAAAATATTAGCTGG + Intronic
1072672357 10:97439890-97439912 AAAACATTGAAAAGATTTGTGGG - Intronic
1072968336 10:99994316-99994338 AAAACATTTAATACATTTCCTGG + Intronic
1073228370 10:101944511-101944533 AAAATATTAAAAGCATTCAGAGG + Intronic
1073999000 10:109348730-109348752 AAAACTTTCAAACCATTTGCTGG + Intergenic
1074253848 10:111780860-111780882 AAATAATTTAACACATTTGGGGG + Intergenic
1074368812 10:112882296-112882318 CAAACAGTTAAAGGATTTGGGGG - Intergenic
1074670326 10:115783291-115783313 AGAACATTAAAAGCATTTTTTGG - Intronic
1074996457 10:118760900-118760922 AAAATAGTTAAAACATTGGGGGG + Intergenic
1075327658 10:121547554-121547576 AAAAAATTTAAACCATTAGCTGG - Intronic
1076444522 10:130503361-130503383 AGAACATTTAGAGAATTTTGAGG + Intergenic
1076457964 10:130616006-130616028 AAAATATTTAAAACAGCTGGTGG - Intergenic
1077660661 11:4065733-4065755 GAGGCATTTAAAGCATTTGTTGG + Intronic
1078168199 11:8909232-8909254 GAAACATTTAAAAAATTTGCAGG + Intronic
1078277336 11:9862156-9862178 ATAATATTTTAAGTATTTGGGGG - Intronic
1078825597 11:14927275-14927297 AAAACATTTAAAAAATTTAGTGG + Intronic
1079802723 11:24890847-24890869 AAAAAATATAAAGCATTTTAGGG + Intronic
1079929784 11:26543441-26543463 AAGAAATTAAAAGCGTTTGGTGG - Intronic
1080372394 11:31666307-31666329 AAAATATTTAAAGAATCTGAAGG - Intronic
1080567895 11:33528953-33528975 AAAACATTTCAATAATTTTGGGG - Intergenic
1081930125 11:46863930-46863952 GCTACGTTTAAAGCATTTGGGGG + Intronic
1085852513 11:80138412-80138434 AAAATATTTAATGAATTTGTAGG + Intergenic
1086604055 11:88673674-88673696 AGTACAGTTAAACCATTTGGGGG - Intronic
1086607232 11:88710301-88710323 AAAATATTTAACGGATGTGGTGG - Intronic
1086724474 11:90166156-90166178 AAAACATTTAAAGCTGTGTGTGG - Intronic
1087104262 11:94394641-94394663 AAAACCTTGAAAACATTGGGAGG - Intronic
1087165618 11:94999603-94999625 AAAACATTTATGGCATTGTGTGG + Intergenic
1087408341 11:97757428-97757450 GAAACATTTATATCTTTTGGAGG - Intergenic
1087523851 11:99281997-99282019 AAAACAAACAAAACATTTGGTGG - Intronic
1088117867 11:106333022-106333044 GCAATATTTACAGCATTTGGTGG - Intergenic
1088160343 11:106862562-106862584 GAAACATTTAAAACCTTTGTGGG + Intronic
1088283508 11:108162157-108162179 AAAACAAGTAAATAATTTGGTGG - Exonic
1088340794 11:108764042-108764064 AAAACAACTAAAACCTTTGGTGG + Intronic
1088351287 11:108891195-108891217 AAAAGATTTTAAGCATTTTGAGG + Intronic
1088491332 11:110390922-110390944 CAAACCTTTTAAGCATTTGTAGG - Intergenic
1088529002 11:110787771-110787793 AAAACATTAAAACCCTTTGTTGG + Intergenic
1088602677 11:111495451-111495473 AAAAAATTTCTAGCACTTGGCGG + Intronic
1088608568 11:111555269-111555291 AAAACATTTAAAGAAAGTAGAGG + Exonic
1089629685 11:119776667-119776689 AGAACAATGAAAGCATGTGGGGG - Intergenic
1090012483 11:123057682-123057704 CACACATTTAAAACATTTGAAGG - Exonic
1090140034 11:124247571-124247593 CAAACATTTAAGGTATTTTGGGG + Intergenic
1091646882 12:2279819-2279841 AGATGATTTAAAGCATATGGAGG + Intronic
1092621681 12:10278386-10278408 CTAATATTTAAAGTATTTGGTGG + Intergenic
1093545222 12:20337608-20337630 AAAAAAGTTAAAACATTTGGAGG - Intergenic
1093610901 12:21155258-21155280 AAAACATTGAAAGCATATATAGG - Intronic
1093655159 12:21686627-21686649 AAAACATTTAAAGCATTCACTGG + Intronic
1094049357 12:26202065-26202087 AAATGATTTAAAGCATATGTAGG - Intronic
1094392341 12:29965144-29965166 AAATCAGTTTAAGTATTTGGGGG - Intergenic
1094540567 12:31360119-31360141 AAAAAATTTAAATCAATTGTAGG - Intergenic
1094696361 12:32823009-32823031 AAAACATTAGAAGCATTAGAGGG + Intronic
1094740951 12:33288048-33288070 AAAACATTTATTACTTTTGGTGG + Intergenic
1095351128 12:41213977-41213999 AAAAAATTTAAAGCAATGCGTGG + Intronic
1095686169 12:45036632-45036654 ATAACATTTAAATCATTTCTTGG - Intronic
1095977136 12:47947440-47947462 AAAATATTTTAAGCAGCTGGTGG - Intergenic
1096965482 12:55623676-55623698 AGATGATTTAAAGCATATGGGGG - Intergenic
1098294453 12:68990449-68990471 CAAACATTTAAAACTTTTGAGGG - Intergenic
1098350181 12:69551188-69551210 AAAACATTTAAAAAATTAGCTGG + Intronic
1098872449 12:75832369-75832391 ACAACATGTAAAGAATTTGAAGG + Intergenic
1098891640 12:76015327-76015349 AAAACATTTAAACAATTAGCTGG + Intergenic
1099422683 12:82482457-82482479 AAGATATTTATAGGATTTGGAGG + Intergenic
1099917761 12:88916185-88916207 AAAAGTTTTAAAGCAGCTGGTGG + Intergenic
1100898339 12:99210895-99210917 CAAACATTTAAAACTTTTGAGGG - Intronic
1100949039 12:99824630-99824652 AGAACATCTGAATCATTTGGAGG + Intronic
1101074140 12:101110584-101110606 AAAACATATTAAACATCTGGTGG + Intronic
1101271687 12:103153207-103153229 AAAAACTACAAAGCATTTGGAGG + Intronic
1101309099 12:103559957-103559979 AAGACAGTTAAAGCACTAGGGGG + Intergenic
1103185962 12:118957648-118957670 GAGCCATTTAAAGCTTTTGGAGG - Intergenic
1103814121 12:123639147-123639169 TAAACATTTAAGGCATATAGTGG + Intronic
1104096921 12:125566471-125566493 ACAACATTTCGAGCATTTGCTGG + Intronic
1104124221 12:125830123-125830145 AAAAAAATTAAAGCAATTGATGG + Intergenic
1105059864 12:133139415-133139437 AAAACATTTAGGGCATAGGGAGG + Intronic
1105721426 13:23119194-23119216 CAAAAATTTAAAGTATTTTGAGG - Intergenic
1106009017 13:25800034-25800056 AAAACACTTAAAGCAATGGACGG - Intronic
1106650756 13:31687868-31687890 AGATTATTTAAAGCATATGGGGG + Intergenic
1107073482 13:36297139-36297161 GAAACATTTAAAGTATTTTTTGG - Intronic
1107097347 13:36550848-36550870 AAAACAATTAGATCAGTTGGTGG + Intergenic
1108862940 13:54884596-54884618 AAAAAAAAAAAAGCATTTGGTGG - Intergenic
1109017530 13:57037564-57037586 TAACTATTTAAAACATTTGGCGG + Intergenic
1109068144 13:57727462-57727484 AAAATATTGATGGCATTTGGCGG - Exonic
1109711191 13:66162745-66162767 AAAACATTTAAAAAATTAGCTGG - Intergenic
1110198522 13:72819766-72819788 AAAGCCTTTAAAGTATTTAGCGG - Intronic
1110347096 13:74461357-74461379 AAAACATATAAATCATCTTGTGG - Intergenic
1110897152 13:80768495-80768517 AAACCATCTTAAGCATTTGATGG - Intergenic
1110911600 13:80972445-80972467 TACACATTTAAATAATTTGGGGG + Intergenic
1110960910 13:81624526-81624548 AAAACATTTAACGCAGTTCCTGG - Intergenic
1111274374 13:85928380-85928402 AAAACATTTATATCTGTTGGGGG - Intergenic
1112690339 13:101886104-101886126 AAAACATTTACAGCTTTATGTGG + Intronic
1113160595 13:107376363-107376385 AAAACAGTTGAAGAATGTGGAGG - Intronic
1113294992 13:108949485-108949507 AAAACATGTACAGAATCTGGAGG + Intronic
1114404309 14:22441287-22441309 AAGACATTTGGAGCATTTGGAGG + Intergenic
1115086448 14:29521204-29521226 AAATAATTTAAGGTATTTGGGGG - Intergenic
1115188263 14:30717599-30717621 AAATCATTCAAAGCATTTTGCGG + Intronic
1116591683 14:46784782-46784804 AAAATATTTAAAGACTTTGTTGG + Intergenic
1116644116 14:47504359-47504381 ATAACATTTACAACAGTTGGTGG + Intronic
1116752838 14:48908584-48908606 TAAACATTTAAAGCACTTTCTGG + Intergenic
1116819184 14:49611174-49611196 GAAACATTTAAAACATCTGAAGG + Intronic
1117349222 14:54864507-54864529 AAAACATTTGAGACAATTGGAGG - Intronic
1117384426 14:55196458-55196480 AAATCATTTAAATCATTCTGTGG + Intergenic
1117426354 14:55602034-55602056 AAAAAATATAAAGCACTTGAGGG - Intronic
1119358772 14:74030034-74030056 AAAACAGTTTAAGATTTTGGGGG + Intronic
1119838205 14:77770224-77770246 AAAAGTTTTAAAGCATGTGAAGG - Intergenic
1120350301 14:83348091-83348113 AAAATATTTCAAGAATTTTGTGG + Intergenic
1120374432 14:83684056-83684078 AAAACATTTAAATCATAAGCTGG + Intergenic
1121891579 14:97597403-97597425 AAAACCTTAAAAGCAGTAGGAGG + Intergenic
1122735562 14:103838146-103838168 ACAACAATAAAAACATTTGGTGG + Intronic
1123160622 14:106275152-106275174 AAAACATTGTAAGCTCTTGGGGG - Intergenic
1123538928 15:21267775-21267797 AAAACATTCAAAGCATTTAAAGG + Intergenic
1123958180 15:25362992-25363014 AAACCTTTTAAAGGATGTGGTGG + Intronic
1124070095 15:26383353-26383375 AAAACATTTTTAGCAATTTGGGG - Intergenic
1124989698 15:34659450-34659472 AAAGCATAGAAACCATTTGGAGG + Intergenic
1125665193 15:41425025-41425047 AAAAAATTTAAAGCCACTGGAGG + Intronic
1125967466 15:43886001-43886023 AAAACCTATGAAGCATTTTGGGG - Intronic
1126288654 15:47045773-47045795 CAAACATTTAAAACCTTTGATGG + Intergenic
1126631892 15:50744977-50744999 AAAACATTTAAAACTGTTGTTGG + Intronic
1126665910 15:51076528-51076550 AAAACAGTGAAACCTTTTGGTGG - Intronic
1127224177 15:56912997-56913019 AAAACAAACAAAACATTTGGGGG + Intronic
1127744023 15:61945362-61945384 GAAACTTTTCAGGCATTTGGAGG - Intronic
1128170219 15:65504819-65504841 AAAACATTTAAAAGATTAGCTGG + Intronic
1128624997 15:69191986-69192008 AAAACATTTAAAGCAGCCAGAGG - Intronic
1128989942 15:72251168-72251190 CAGAAATTTAAAGCATTTAGAGG + Intronic
1129763665 15:78147642-78147664 AAAATATGGGAAGCATTTGGGGG + Intronic
1130006428 15:80103384-80103406 AAAAAATTTGGAGAATTTGGTGG + Intronic
1130933876 15:88452238-88452260 AGAATATTTAAAGCTCTTGGGGG + Intergenic
1131344092 15:91630078-91630100 AAGATATTTCAAGCATTTTGAGG - Intergenic
1131420966 15:92305041-92305063 AGTGCATTTAAAACATTTGGAGG + Intergenic
1131578448 15:93615606-93615628 AAAGTATGTAAAGCCTTTGGGGG + Intergenic
1131646224 15:94348295-94348317 AAGACAGTCATAGCATTTGGAGG + Intronic
1133778006 16:8913052-8913074 AAAACCTTAAAAGCACATGGGGG + Intronic
1135699107 16:24615881-24615903 AAAAAATTTAGAGCATGTAGGGG - Intergenic
1137741644 16:50782312-50782334 AAAATCTTTTCAGCATTTGGAGG + Exonic
1137833609 16:51569037-51569059 AAAAGATTTGAAGCATTAGTTGG + Intergenic
1137848610 16:51715714-51715736 AAAACATATAAGGCTTTTGCAGG + Intergenic
1139055844 16:63182425-63182447 AAAACATTAAAAAAATTGGGGGG - Intergenic
1140160015 16:72480031-72480053 AAAACATATAAAGGACTTGTAGG + Intergenic
1140388676 16:74565550-74565572 AACACAGTTTAAGCAGTTGGCGG - Intronic
1141739636 16:85882436-85882458 GAAACATTTGAAGCCATTGGGGG + Intergenic
1143072627 17:4309911-4309933 AAAAGATTTCAAGAACTTGGGGG - Intronic
1144255917 17:13466946-13466968 GAAACAGTTAAAGAAGTTGGTGG - Intergenic
1144311937 17:14021950-14021972 AAAACACTTAGAGCAATTGCAGG - Intergenic
1144332822 17:14239369-14239391 AAAACACTTAGAGCAATTGCAGG + Intergenic
1146021074 17:29279672-29279694 AAAAAATTTGAAGCATTAGCTGG - Intronic
1148621382 17:49037064-49037086 AAACCATTTCAAGCATTTCAAGG + Intronic
1148944322 17:51245796-51245818 AAAACATTAAAAGATTTTTGAGG - Intronic
1149094142 17:52820289-52820311 AAAACATTTAAAATATTTTTAGG - Intergenic
1149298445 17:55282776-55282798 AAAAAATTTAAAGCCTCTTGGGG + Intronic
1150202615 17:63373054-63373076 AAAAAATTTAAAAAATTAGGCGG - Intronic
1150614355 17:66757549-66757571 GAAATATTTAAAGCTTTGGGAGG + Intronic
1151243872 17:72779450-72779472 AAAAAATAAAGAGCATTTGGAGG + Intronic
1152171217 17:78750270-78750292 AAAACATTCAAAACATTTGATGG + Intronic
1153440481 18:5112614-5112636 AAAAAATTTAAAACATTAGCTGG - Intergenic
1153566876 18:6427605-6427627 AAAACACTTAAAACACTTGGAGG - Intergenic
1155625725 18:27832450-27832472 AAAAAATTTTCAGCATTTGATGG + Intergenic
1155769583 18:29680282-29680304 AAAACATTTAAATCACTTTGGGG - Intergenic
1156014237 18:32529545-32529567 AAAATATTAAAACAATTTGGGGG - Intergenic
1156122906 18:33866103-33866125 CAAACATTGACAGCATTTGCAGG + Intronic
1156753482 18:40491049-40491071 AAAACATTTAAAGCAATCTTAGG - Intergenic
1157743053 18:50110160-50110182 CAAACACTTGAAGCATTTGAGGG - Intronic
1157817446 18:50740343-50740365 AGATTATTTAAAGCATATGGAGG + Intergenic
1157914871 18:51655004-51655026 AAAACAATGAAAGCATCTGCAGG - Intergenic
1158238516 18:55348868-55348890 ACAATATTAAATGCATTTGGTGG - Intronic
1158578009 18:58656516-58656538 AATACATTTAAAGCAATAGTGGG + Intergenic
1159331567 18:67001066-67001088 AAAATATTTAAAGCATTATGTGG + Intergenic
1159382418 18:67678077-67678099 AAAATATTGAAAGAATTTTGAGG - Intergenic
1159558560 18:69970306-69970328 GAAACATATAAAGCATTAGAGGG - Intergenic
1159786041 18:72715553-72715575 AAAGCAACTAATGCATTTGGTGG + Intergenic
1159859706 18:73632790-73632812 ATAACATTAAGAGTATTTGGGGG - Intergenic
1159905874 18:74091794-74091816 AAAACATTAAAGGCAGCTGGGGG - Intronic
1160661749 19:304355-304377 AAAATCTTCAAAGCAGTTGGAGG + Intergenic
1161117054 19:2503454-2503476 TAAACATTTAAAGCCTTTACTGG - Intergenic
1161135632 19:2617878-2617900 AAAACATTTAAAAAATTAGCCGG - Intronic
1164201695 19:23024391-23024413 ACAACATCTAAAGAATTGGGAGG - Intergenic
1165590418 19:36964652-36964674 AAAATTTTTAAAAAATTTGGCGG + Intronic
1168092338 19:54094414-54094436 AAAACATTTAAAGCAGTAACTGG - Intergenic
926285613 2:11485125-11485147 AAACCATTTAAACCATCTGCAGG - Intergenic
926760183 2:16271515-16271537 AAAACATAAAAATCATTTTGTGG + Intergenic
927264803 2:21133647-21133669 AAAAAATTTAAAGCATTATAAGG + Intronic
927313536 2:21656280-21656302 AAAGCATTAAAAGCATTAGTTGG - Intergenic
927409815 2:22811800-22811822 AAAAGAATTAAAACATTTGTTGG - Intergenic
928536804 2:32249097-32249119 AATACATTTAAATCATTTAAAGG + Intronic
929002251 2:37358918-37358940 ATTACATGTAAAGCATTTGCTGG + Intronic
929248565 2:39728935-39728957 AAAAAATGCAAAACATTTGGAGG + Intergenic
929844510 2:45509043-45509065 AAAAATTTTAATGGATTTGGTGG - Intronic
929885766 2:45876506-45876528 AATACTTTTCAACCATTTGGGGG + Intronic
930332343 2:50001435-50001457 AAAGTATGTAAAGCATTTAGGGG + Intronic
930614762 2:53582138-53582160 AAAACACAAAAAGCATTTGCTGG + Intronic
930983985 2:57562688-57562710 AATACATTTAAAGCACTTTGAGG + Intergenic
931249725 2:60519246-60519268 AACACCTTTAAGGCATTTTGCGG + Intronic
931308400 2:61055167-61055189 AAAAGATATAAAACATTGGGGGG - Intergenic
931507192 2:62942674-62942696 AAAACATTAAAAGAATTTAATGG - Intronic
931829167 2:66032896-66032918 AAAACATTTTCAGCCTTTGGGGG - Intergenic
931945631 2:67303500-67303522 AAAACATTTGAAGATTTTGAGGG + Intergenic
933405716 2:81856097-81856119 AAAATATTTTAAGAGTTTGGTGG - Intergenic
933663953 2:84949613-84949635 AAAACATTTACATCAGTTGATGG + Intergenic
933747579 2:85582273-85582295 AAAACCTTCATAGCATTTTGGGG + Intergenic
935078016 2:99764925-99764947 AAAAAAATTAAAACATTTGAGGG + Intronic
935122503 2:100195299-100195321 AAGACATTTAAAGAACTTGAAGG + Intergenic
935133047 2:100275547-100275569 GCAACATTTAAACCTTTTGGCGG - Exonic
935573018 2:104681860-104681882 AAAACATTTAAAGCAATTCTTGG - Intergenic
936655471 2:114481005-114481027 AAAACATATAAAGCAGTTAGGGG + Intronic
936975527 2:118217730-118217752 AATACATGTAAAGCACTTGGAGG + Intergenic
937656829 2:124386506-124386528 AAAACAATTAAAACATTTCTTGG - Intronic
938818277 2:134927180-134927202 ATAACATTTAAAGCTTTCTGGGG - Intronic
938991539 2:136634842-136634864 AAAACATTTAGACCATCTGCTGG - Intergenic
939474345 2:142667449-142667471 ATAACATTTAAAGAATTTATAGG + Intergenic
941396176 2:164976442-164976464 AAAACATTCAAAGCATTTAAAGG + Intergenic
941600076 2:167531900-167531922 AAAACATTTAAATTATTTTTTGG + Intergenic
941675024 2:168334593-168334615 AAAGAATTTTGAGCATTTGGAGG + Intergenic
942085496 2:172439612-172439634 AAGACATTGCAAGCTTTTGGTGG + Intronic
942195185 2:173510414-173510436 AAAACACTGAAAGTATTTTGAGG - Intergenic
942332359 2:174840324-174840346 AAAAAATTTAAAACATTAGCTGG - Intronic
942338219 2:174914539-174914561 AAAGCTTTTAAAGCATTTTGCGG - Intronic
942465389 2:176202554-176202576 AAATTATTTAAATCCTTTGGAGG + Intergenic
942860666 2:180606990-180607012 AATACATTAAAAGCATTAGAAGG + Intergenic
944012387 2:194988276-194988298 AATACAGATAAAGCATTTGGAGG - Intergenic
944306669 2:198187387-198187409 AAAACATTTAAAAAATTAGCTGG - Intronic
945079918 2:206078454-206078476 AAAACAATTAAGGTATTTTGTGG - Intronic
945367457 2:208973273-208973295 AGAACATTTAAAACTTCTGGAGG - Intergenic
945501068 2:210576081-210576103 AAAAAATTTAAAGAAATTGAGGG + Intronic
945808620 2:214520838-214520860 TAAACATTTTTAGCATCTGGTGG + Intronic
946545499 2:220737684-220737706 AATAAATTTAAACCCTTTGGAGG - Intergenic
946548109 2:220768325-220768347 ACAATATTTAAATCATTTGAAGG + Intergenic
1168922542 20:1552520-1552542 AAAACAATTAAAGAATGAGGTGG + Intronic
1169144582 20:3244067-3244089 AAAAAATTAAAAATATTTGGAGG - Intergenic
1169956759 20:11111861-11111883 AAAAAATTTCAAGCATTTGTTGG - Intergenic
1171035763 20:21711605-21711627 AGAACCTTTAAAGAAGTTGGAGG - Intronic
1172048743 20:32100202-32100224 AAAAAATTTAAAGAATTAGCTGG - Intronic
1172111944 20:32551948-32551970 AAAACATTTAAAAAATTAGCTGG - Intronic
1172915721 20:38442107-38442129 AAAGCATTTTCTGCATTTGGAGG + Intergenic
1173368999 20:42417897-42417919 AAAACTTTTAAAACATTAGCTGG - Intronic
1174527216 20:51182689-51182711 AAAACTTTTAAAACATTGAGAGG + Intergenic
1175046810 20:56114423-56114445 AAAATATTTAAAGTGTTGGGGGG + Intergenic
1177880482 21:26688719-26688741 AAAACATTTAAGGTTTTTAGAGG + Intergenic
1178565971 21:33685545-33685567 AACACATTTAAAACACTTAGAGG + Intronic
1179135375 21:38675862-38675884 AATACATTTAAAACATCTTGGGG - Intergenic
1179582897 21:42355442-42355464 AAAACTCTTAAAGCAGCTGGAGG + Intergenic
1179971788 21:44840111-44840133 AAGATCTTTAAAGCATCTGGAGG - Intergenic
1180055160 21:45354321-45354343 AAAATATTTAAAGCATGTACAGG - Intergenic
1180684520 22:17654881-17654903 AAAAAATTTAAAACATTAGCTGG - Intronic
1180819575 22:18816859-18816881 AACACATATAAAGCAATTAGGGG - Intergenic
1180900488 22:19368411-19368433 AAAATTTTTAAAGGATTTTGAGG - Intronic
1181205802 22:21251304-21251326 AACACATATAAAGCAATTAGGGG - Intergenic
1181327612 22:22062090-22062112 AAAAGCTTTAAACCCTTTGGGGG + Intergenic
1181341490 22:22183493-22183515 AAAAGATTTAAAATTTTTGGTGG + Intergenic
1181424074 22:22821756-22821778 GAAAGATTAAACGCATTTGGAGG + Intronic
1182597803 22:31435586-31435608 AAAAAATTTAAAAAATTAGGTGG + Intronic
1183385379 22:37511193-37511215 AAAAAATTTAAAACATTAGTTGG + Intronic
1203221119 22_KI270731v1_random:44109-44131 AACACATATAAAGCAATTAGGGG + Intergenic
1203269706 22_KI270734v1_random:42712-42734 AACACATATAAAGCAATTAGGGG - Intergenic
949122038 3:397529-397551 AAAATATTTAAGATATTTGGTGG + Intronic
949270864 3:2215196-2215218 AAAAAATGTATAGTATTTGGTGG + Intronic
951273618 3:20658159-20658181 AAAACATTTAGAGAACTTGCAGG + Intergenic
951276617 3:20695020-20695042 AAATTATTTAAAGTATTGGGGGG - Intergenic
951900099 3:27648403-27648425 AAAACATATAAAGCATTTTATGG - Intergenic
952108451 3:30095440-30095462 AAAGTATTTATTGCATTTGGAGG - Intergenic
954011975 3:47648774-47648796 AAAATAATTTTAGCATTTGGTGG - Intronic
954850647 3:53597011-53597033 TAAACATTTAATGCATTTTCAGG - Intronic
955291848 3:57699298-57699320 AAAAAATTTAAAACATTAGCTGG + Intergenic
956202477 3:66720745-66720767 AAAATATTTAAAGCATTATATGG - Intergenic
957285246 3:78209234-78209256 AATACATTTATTTCATTTGGAGG + Intergenic
957530870 3:81439390-81439412 CAAAGAATTAGAGCATTTGGGGG + Intergenic
957578810 3:82044183-82044205 ATAACATTTATTGCATTTTGTGG - Intergenic
958116158 3:89220579-89220601 ATCAAATATAAAGCATTTGGAGG + Intronic
958517422 3:95135764-95135786 GAAACATTTAAAGCATTGACAGG - Intergenic
958893584 3:99806255-99806277 AAAACATTTAAAGCAGTTTGTGG - Intergenic
959032034 3:101310254-101310276 AATACATTTAAAGGATTAGATGG + Intronic
959098253 3:101980948-101980970 AAAACCTTTAATTCATTTAGAGG - Intergenic
959195477 3:103175265-103175287 AGACCATTTAAGGCAATTGGTGG + Intergenic
959278794 3:104311110-104311132 AAAGCATTTAAGTCACTTGGAGG - Intergenic
960450634 3:117802800-117802822 AAAATATTTATATCATTTAGTGG - Intergenic
960453084 3:117834644-117834666 CCAACATTTAAATCATTTTGAGG + Intergenic
963606553 3:147417273-147417295 CAAACGCTTAAAGCAGTTGGGGG - Intronic
963868873 3:150392151-150392173 AAAAAATGTTAAGCATTTGATGG - Intergenic
964586245 3:158306435-158306457 ATATCATTTAAAGCATTTCTAGG + Intronic
964842505 3:161009294-161009316 AAGACATTTAAAGCATCTATAGG - Intronic
965367984 3:167822386-167822408 AACACATTTTTAGCATTAGGAGG - Intronic
965791706 3:172395567-172395589 CTAACATTTAAATAATTTGGTGG - Intronic
965830322 3:172779041-172779063 AATACTTGTAAAGCATTTAGAGG + Intronic
965990337 3:174810505-174810527 CAACCATTTAGGGCATTTGGTGG + Intronic
966431675 3:179837986-179838008 CAAACATTTAAAACTTTTGGGGG - Intronic
969946899 4:10792682-10792704 AATACATTTAAAGACTTTGAGGG + Intergenic
970069589 4:12142475-12142497 AAAAAATTTAAAACATTAGCCGG + Intergenic
970372385 4:15421071-15421093 AAAACATGTGAGGCATTTTGTGG - Intronic
970624157 4:17858896-17858918 AAAATCTTAAAAGCATCTGGTGG + Intronic
970647825 4:18143241-18143263 TAAACATTTTAAGCTTTTTGAGG - Intergenic
970768690 4:19583767-19583789 GAAACAGTTAAAGCAATTAGAGG - Intergenic
970909396 4:21256731-21256753 ATAATCTTTAAAGCATTTGTTGG - Intronic
971756481 4:30715003-30715025 ATAACATGTTAAGGATTTGGGGG - Intergenic
971823500 4:31590979-31591001 ACAACATTTACAGCAATTGGAGG - Intergenic
971826608 4:31631431-31631453 AAAACACTTAAAGCAATTTTGGG - Intergenic
972001673 4:34044158-34044180 AGAACATTGAAAACATTGGGAGG - Intergenic
972309509 4:37866856-37866878 ACTACATTTAAAGCAATTTGAGG - Intergenic
972957888 4:44415322-44415344 AAAACATTTGAAAAATTTGCAGG + Intronic
974420555 4:61667637-61667659 TAAACTTTTAAAGCATTTTATGG - Intronic
975142745 4:70935086-70935108 AAAAAATTTAAAACATTAGTCGG - Intronic
975179446 4:71327573-71327595 AAAACATTTAACACATTTCCTGG + Intronic
975610336 4:76196659-76196681 AATACATTTAAAGCCCCTGGTGG - Intronic
975636510 4:76455373-76455395 TAAACATTTATATCATTTGGGGG + Intronic
975739359 4:77414009-77414031 AAAACACTTTAAATATTTGGAGG + Intronic
975963001 4:79935382-79935404 AAATTATTTAAAGCCTGTGGGGG + Intronic
976248534 4:83027348-83027370 AAAAAATTTAAAGAATTAGCTGG + Intergenic
976570378 4:86600784-86600806 TAAACATTTAAATTATTTAGGGG + Intronic
976999909 4:91484118-91484140 AAAAAATTTAAAACAGCTGGTGG - Intronic
977057225 4:92208080-92208102 AGAATCTTAAAAGCATTTGGAGG - Intergenic
977132868 4:93265272-93265294 AAAATATTTATAACAATTGGAGG + Intronic
977747497 4:100567670-100567692 AAAAAAATTAATGGATTTGGTGG + Intronic
978566470 4:110087730-110087752 GAAACATTTAAAACTTCTGGTGG + Intronic
979124973 4:116958020-116958042 AAAACACTTAAAGTCTCTGGAGG - Intergenic
979192054 4:117873790-117873812 AAAGCATTTAAATCATTCAGAGG + Intergenic
979311343 4:119207588-119207610 AAATCATTTAAATCATTTGTAGG + Intronic
979475187 4:121148701-121148723 AAAAATTTTATAGCATTTGATGG - Intronic
979641240 4:123014224-123014246 TAAATATTCAAAGCATTTGCTGG + Intronic
980136749 4:128865413-128865435 AAAACATTTAAACCATCTCCAGG - Intronic
980177749 4:129367105-129367127 AAAACATATCTAGCATATGGAGG + Intergenic
980305318 4:131053441-131053463 AAATGATTTAAAGTATATGGAGG - Intergenic
980711691 4:136577254-136577276 AGAACAGATAAAGCATTTGCAGG - Intergenic
981065977 4:140486211-140486233 AAAACAATGAAAGGATATGGGGG - Intronic
981140819 4:141266868-141266890 AAAATATTTAAAGTATATGCAGG - Intergenic
983310125 4:166048964-166048986 AAAATATTTAAAGGATTTAGAGG - Intronic
983533675 4:168834952-168834974 GAAACATATAAAGCATTTCCTGG + Intronic
983909962 4:173226888-173226910 AACATATTTAAAGTATTTCGAGG - Intronic
984084576 4:175293118-175293140 AAAATATTTAAAGCTTTTTAGGG + Intergenic
984364310 4:178778454-178778476 ATGACATTTAAAGCATGTTGAGG + Intergenic
984471037 4:180174164-180174186 AAAACATTTTAATAATTTGAAGG + Intergenic
984614977 4:181887016-181887038 AAAGTATTTAAAGTATTTGCTGG - Intergenic
985158786 4:187021822-187021844 AAAATATTTCATTCATTTGGAGG + Intergenic
986006789 5:3674813-3674835 AAATTATTTAGAGCTTTTGGGGG + Intergenic
986395918 5:7330376-7330398 AAAACATTCAAAGCATTTGAGGG - Intergenic
987530167 5:19108133-19108155 AAAACACTTAACACATTTGGTGG - Intergenic
987532939 5:19144484-19144506 AAATCATTTAAAACATTTTAAGG + Intergenic
987947721 5:24634121-24634143 AAAACCTTTAAAGAATTTGAAGG + Intronic
988010946 5:25484803-25484825 ACAACATTTAAAGCAACCGGAGG - Intergenic
988350361 5:30097290-30097312 AAAAGATTTAAATCATTATGAGG + Intergenic
988389849 5:30613749-30613771 AAAAGATCAAAAACATTTGGCGG + Intergenic
988714242 5:33809357-33809379 AATATCTTCAAAGCATTTGGGGG - Intronic
989691324 5:44147903-44147925 AAAACATTTCAGGAATTTAGGGG + Intergenic
989750694 5:44889362-44889384 AAAACATTTAAAGAATATCCTGG + Intergenic
990104024 5:52233553-52233575 ACAAAATTTAAAGCAGTAGGAGG + Intergenic
990193021 5:53281908-53281930 AAAGCATATAAAACTTTTGGAGG - Intergenic
990250757 5:53912558-53912580 AAAACATTGAAAGGATTCTGTGG - Intronic
990378250 5:55194966-55194988 AATACAATTAAAGGATTGGGAGG + Intergenic
990436320 5:55795609-55795631 AAAACATTTAAAAAATTAGCTGG + Intronic
990549987 5:56865435-56865457 AAAAACTTTAAAGAATTTTGAGG + Exonic
990673599 5:58160007-58160029 AAACCATTTTAAAAATTTGGTGG + Intergenic
991477435 5:67037468-67037490 AGTACATAAAAAGCATTTGGAGG + Intronic
992231214 5:74666164-74666186 AAACCATAGAAAGCATTTGAGGG + Intronic
992512936 5:77457989-77458011 AAAAAATTTAATGTATTTGGGGG - Intronic
993281595 5:85932047-85932069 AAAACATTTACAGTTTCTGGGGG + Intergenic
993462729 5:88204415-88204437 AAAACATTTAAAGCATTTGGTGG - Intronic
993636138 5:90346108-90346130 AAGAGATTTAAATCATTGGGAGG - Intergenic
993786807 5:92149182-92149204 AAAACATATAAATCATTTTTGGG - Intergenic
994475932 5:100269705-100269727 AAAACATAAAAAACATTTGCAGG + Intergenic
994688034 5:102981837-102981859 AAATCATTTTAAACATTTGGTGG + Intronic
995074263 5:107963034-107963056 AAAACACTTAAAATATTTGGAGG + Intronic
995716901 5:115089299-115089321 TAAAAGTATAAAGCATTTGGGGG + Intergenic
995795777 5:115940112-115940134 AATACTTTTAAAACATATGGGGG - Intergenic
996612436 5:125398577-125398599 TTAAAATTTAAGGCATTTGGGGG - Intergenic
997088518 5:130828732-130828754 AAAACATCTAAAGCATCCTGTGG + Intergenic
997330559 5:133058229-133058251 AAAAAATTTAAAACATTAGCAGG + Intronic
997567328 5:134898772-134898794 AAATTATTAAAAGCATTTTGGGG + Intronic
998379286 5:141712555-141712577 AATACATAGAAAGCACTTGGAGG - Intergenic
998856046 5:146395991-146396013 AAAACATTTAAAAAATTAGCTGG - Intergenic
999026748 5:148242136-148242158 AAACCATTTAAAGGAATTGGGGG + Intergenic
999565080 5:152850653-152850675 GAAATATTTAAAGCATTAAGGGG - Intergenic
999937961 5:156508444-156508466 AAAACATGTAAAATATTAGGAGG - Intronic
1001973243 5:175974106-175974128 AAATAATTTAAAATATTTGGGGG + Intronic
1002244194 5:177869677-177869699 AAATAATTTAAAATATTTGGGGG - Intergenic
1004368267 6:15030263-15030285 AAAAAATTTAAAACATTAGCTGG + Intergenic
1005641400 6:27799902-27799924 AAAACTTTTAAAAAATTAGGCGG + Intergenic
1006238788 6:32659749-32659771 AAGACACTGAAAGCATTTTGGGG - Exonic
1007056170 6:38887543-38887565 AAAAAATTTAAAACATTAGCTGG + Intronic
1007401754 6:41606658-41606680 CAAACATTTAAATAATTTGTAGG + Intergenic
1008011199 6:46469487-46469509 AAAACCTACAAAGCATTTGGGGG + Intronic
1008020484 6:46572062-46572084 AAAACATATAATGCATGTGGGGG - Intronic
1009637309 6:66282319-66282341 AAAACACTTTAAGACTTTGGTGG + Intergenic
1010254123 6:73738674-73738696 AAAAAATGAAAAGCATTTGCAGG + Intronic
1011187646 6:84696716-84696738 AAGAAAATTAAAGCATATGGAGG - Intronic
1011518630 6:88180034-88180056 GAAACATTGAATGGATTTGGAGG + Intergenic
1011711615 6:90060604-90060626 CAAACATCTAAAGCCCTTGGTGG + Intronic
1012523006 6:100143396-100143418 AATACATTTAAATAAATTGGGGG - Intergenic
1012846660 6:104397857-104397879 CAAACCTTTGAAGTATTTGGAGG - Intergenic
1012915991 6:105171507-105171529 AAAAAATTAAAAGAATTTGTTGG + Intronic
1013084769 6:106846928-106846950 CAAACAGTTGAGGCATTTGGGGG + Intergenic
1013351586 6:109310771-109310793 AAAAAAAATAAAGCATTTTGTGG + Intergenic
1013374828 6:109504200-109504222 AAAACATTTAAAAAATTAGCTGG + Intronic
1013707531 6:112856035-112856057 ATAATATTTAAAGCATATGGAGG - Intergenic
1013710685 6:112894098-112894120 AAAACATTAGAAGCAGTTGAGGG + Intergenic
1014195300 6:118550744-118550766 ATATCATTTACAGTATTTGGGGG - Intronic
1014208607 6:118684338-118684360 AAAAAATTTAAAGCATTGGCTGG + Intronic
1015081581 6:129232525-129232547 AATAAAATTAAAACATTTGGGGG - Intronic
1015726920 6:136308608-136308630 AAAACATTTTAAAAATTAGGTGG + Intergenic
1015899287 6:138047872-138047894 AGATGATTTAAAGTATTTGGTGG - Intergenic
1016076145 6:139797851-139797873 AAAATGTTAAAAGCATTTGCAGG - Intergenic
1016171973 6:141029069-141029091 AGAATATTTAAAGCAATTGCTGG - Intergenic
1016246098 6:141982915-141982937 AAAACATTTAAAGATTGTCGTGG - Intergenic
1016379638 6:143461784-143461806 AAAAAATTTAAAACATTAGCTGG + Intronic
1016720596 6:147292470-147292492 AAAACATTTCAAGCAGTTTCTGG + Intronic
1017032320 6:150235248-150235270 AAAAAATTTAAAACATTGGCTGG - Intronic
1017386467 6:153890693-153890715 TAAACATTTAAAGGTTTTGAGGG - Intergenic
1017732612 6:157330966-157330988 AAAACAGTCAAAGCATTTGATGG + Intergenic
1018251522 6:161876471-161876493 AAAACATTTAAAAAATTAGCTGG - Intronic
1018651617 6:165996800-165996822 AAAATATTTAATGCATTTTAAGG + Intergenic
1019378587 7:709826-709848 AAAACATTTAAAAAGTTTGCTGG - Intronic
1020172460 7:5855822-5855844 AAAAGAATTAAAGCTTTTGGTGG - Intergenic
1020615399 7:10453282-10453304 CACACATTTAAAACATTTGAAGG + Intergenic
1020984253 7:15112538-15112560 AAAATTTTTTAAGAATTTGGTGG - Intergenic
1021267463 7:18542412-18542434 AAAACATTTAAAGCAGTTCCTGG + Intronic
1022786498 7:33643137-33643159 ATAACTGATAAAGCATTTGGGGG - Intergenic
1022964324 7:35458464-35458486 AGATGATTTAAAGCATCTGGTGG - Intergenic
1023216183 7:37865666-37865688 TAAAGATTTAAAGCTTATGGAGG - Intronic
1023776706 7:43614924-43614946 AAAACATTTAAACTATTTTAAGG + Intronic
1023957559 7:44899176-44899198 AAAACATTTCAAGAAGTTGAAGG - Intergenic
1024358064 7:48438039-48438061 AAACCATGGAAGGCATTTGGTGG - Intronic
1024395063 7:48857102-48857124 AAAACATTGTAAGTATTTGGAGG - Intergenic
1024395745 7:48864754-48864776 AAAAAATTAAAGGGATTTGGGGG + Intergenic
1024399489 7:48907522-48907544 AAAAAATTAAAGGGATTTGGGGG - Intergenic
1024400207 7:48915583-48915605 AAAACATTGTAAGTATTTGGAGG + Intergenic
1024997312 7:55282000-55282022 TAAACATTTAAAACCTTTGAGGG + Intergenic
1026448164 7:70503677-70503699 AAAAAATTTAAAACATTAGCAGG - Intronic
1026552509 7:71380479-71380501 AAAACATTTAAAAAATTAGCCGG - Intronic
1026668517 7:72365589-72365611 AAAAAATTTAAAAAATTTGCAGG - Intronic
1027178056 7:75917227-75917249 AAAACATTTAAAAAATTAGCTGG - Intronic
1027372699 7:77522942-77522964 AAAACTTTTAAAGAATGTGAAGG - Intergenic
1027553908 7:79638274-79638296 AAATCATTTAAATTATGTGGTGG + Intergenic
1027741104 7:82006573-82006595 AAAACATTTAAACCTTGTGTAGG + Intronic
1027824717 7:83096501-83096523 AAAATATTTAAACCATGTGAAGG + Intronic
1029240073 7:99154020-99154042 AAAACATTTAAAGTGTTTTTTGG - Intergenic
1029279244 7:99426074-99426096 AAAACATTTAAAAAATTGGCCGG + Intronic
1029555646 7:101267221-101267243 AAAAAAATTAAAACATTTGTGGG - Intergenic
1029627587 7:101729983-101730005 AAAACATTTAAAACATTAGCTGG - Intergenic
1029812671 7:103065045-103065067 CAACCAGTTAAAGCACTTGGTGG - Intronic
1030085188 7:105809930-105809952 AAAAAATTTAAAAAATTAGGTGG - Intronic
1030442987 7:109612472-109612494 AAAAAATTTAAAACATTTGCTGG - Intergenic
1031529858 7:122863481-122863503 TAGACATTTAAAACATTTGTGGG - Intronic
1032282901 7:130519305-130519327 AAAAGATTTGAAGCAATTGGTGG + Intronic
1032373709 7:131387204-131387226 AAGAAATTTAAAGTCTTTGGTGG + Exonic
1033177578 7:139139439-139139461 AAAACATTTAAAAAATCTGAAGG + Intronic
1033714144 7:143981972-143981994 AAAACAAATTAAGCATTTGGAGG - Intergenic
1034366144 7:150550602-150550624 AAAGCATTGAAAGCAGATGGAGG + Intergenic
1035889533 8:3328481-3328503 ACAATATTTGAAGTATTTGGAGG - Intronic
1036464749 8:8986302-8986324 ACAACATTTACAACATTTTGAGG - Intergenic
1037500162 8:19477817-19477839 AAAACATTTCAAGCACTTGATGG + Intronic
1037837492 8:22222851-22222873 AAAAAATTTAAAGAATTAGCCGG - Intronic
1038005519 8:23426694-23426716 AAAACACTTAAAACATTTGGTGG - Intronic
1038297002 8:26302325-26302347 AAAATATTTTAAGTATTGGGAGG - Intronic
1038509472 8:28117668-28117690 AAAACATTTAAAGTGTGTGTTGG - Intronic
1039160024 8:34607813-34607835 AAAACATTTAAAAAATTAGCCGG - Intergenic
1039300435 8:36203105-36203127 AAAACACTGACTGCATTTGGAGG + Intergenic
1040448223 8:47518075-47518097 AAAATATTTAAAGTAATTGTAGG + Intronic
1041797735 8:61763294-61763316 AGAATATTAATAGCATTTGGAGG - Intergenic
1042390992 8:68233629-68233651 AATACAGGCAAAGCATTTGGAGG - Exonic
1042708988 8:71694128-71694150 AAATCATTTAAAGCACAAGGGGG + Intergenic
1043773361 8:84233344-84233366 AAAAAATCTGATGCATTTGGTGG + Intronic
1043824018 8:84902930-84902952 AAAAAATTAAAATGATTTGGTGG + Intronic
1044374067 8:91448683-91448705 AAAATATTTAAAGAATTAGCCGG - Intergenic
1044721028 8:95147046-95147068 AAAAGATTTGAAGCCTTGGGAGG + Intronic
1045562293 8:103276397-103276419 AAATCATTCAAAGTATCTGGAGG - Intergenic
1046543457 8:115616570-115616592 AAAACATTCAGAACAGTTGGTGG - Intronic
1046759563 8:118007303-118007325 AAAACAAAAAAAGCATTTGATGG + Intronic
1046823103 8:118656746-118656768 AAAAATTTGAAAGCATTTGAAGG - Intergenic
1047363419 8:124190597-124190619 GGAGCATTTAAAGTATTTGGGGG - Intergenic
1047692158 8:127366845-127366867 AAAACATTTAGCTCATTTTGAGG - Intergenic
1048058483 8:130892559-130892581 AAAACAGTTTAATCATTTGGGGG + Intronic
1050916577 9:11142784-11142806 AAAACATTTAAAACATTAGCTGG - Intergenic
1052403451 9:28029847-28029869 ATAACTTTGAAAGCATTTGTTGG + Intronic
1052715970 9:32117473-32117495 AAAGCATTTAAAGCATTGGATGG + Intergenic
1054922830 9:70559054-70559076 AAAACATTTCAACCATTGGAAGG - Intronic
1055970556 9:81907753-81907775 CAAACATTTAAAACTTTTGAGGG + Intergenic
1056338254 9:85599361-85599383 AGAACAATAAAAGCATTTGTTGG - Intronic
1056340378 9:85624500-85624522 AAGACATTTTAGGCATTTTGTGG - Intronic
1056785301 9:89588423-89588445 AAAATATTTTAAGTATTTGGTGG - Intergenic
1057045195 9:91880390-91880412 AATATATTTAAAGCATTTGTAGG + Intronic
1058255908 9:102763475-102763497 GAAATATTTAAAGGATTTGGAGG - Intergenic
1058310070 9:103489585-103489607 AAAAAATGTAAAGCTTTTGGAGG - Intergenic
1058365909 9:104208037-104208059 AAAATATTTAAAGTATTGTGAGG + Intergenic
1058404224 9:104653692-104653714 AAAACATCAAAACCATTTAGAGG + Intergenic
1058543609 9:106037811-106037833 AAAACACTTAAAGAAACTGGTGG - Intergenic
1059992501 9:119878491-119878513 AAAACATTAAATCCATTTGCTGG + Intergenic
1060088684 9:120723784-120723806 AAAGAATTTGAACCATTTGGGGG + Intergenic
1061161931 9:128900406-128900428 AGCACTTTAAAAGCATTTGGGGG + Intronic
1186315718 X:8367941-8367963 ACAAAATTTAAAGTACTTGGGGG + Intergenic
1186619864 X:11227763-11227785 AAGATTTTAAAAGCATTTGGAGG - Intronic
1186791150 X:13000273-13000295 AAAACATTTAAATAATGTGAGGG - Intergenic
1186806108 X:13141229-13141251 ATAACTTTTAAAGTTTTTGGGGG - Intergenic
1186984828 X:15000830-15000852 AAAAGAGGCAAAGCATTTGGAGG - Intergenic
1187439112 X:19301760-19301782 AAAAATTATAAAACATTTGGAGG - Intergenic
1188102071 X:26100954-26100976 AAAACATTAAAAACATTAGAGGG + Intergenic
1188132209 X:26450455-26450477 AATACATTAAAAGTATTTTGAGG + Intergenic
1188250966 X:27893791-27893813 CAAACATTTAAAGGCTTTTGAGG - Intergenic
1188299056 X:28484843-28484865 AAAACCTTTAACTGATTTGGTGG + Intergenic
1188319590 X:28720077-28720099 AATATATTTCAAGAATTTGGGGG - Intronic
1188944984 X:36289638-36289660 AAAAATTTTAAAGCACTTGTTGG + Intronic
1189666654 X:43362367-43362389 AAAACATTTATAGTATGTGGAGG - Intergenic
1189901838 X:45714451-45714473 GAAACTTTTAAAGCATGTGATGG + Intergenic
1193570010 X:83129394-83129416 AAAATTTTTAGAGCATTTAGAGG + Intergenic
1193607095 X:83582174-83582196 AAAACATTTTATGCATTTAAAGG + Intergenic
1195879837 X:109581008-109581030 AAAAATTTTAAAGCATCTAGAGG - Intergenic
1196186323 X:112748459-112748481 AATTCATGTAAAGCATTTAGGGG - Intergenic
1196284028 X:113858797-113858819 AAAACATCAAAAGCAATTGCAGG - Intergenic
1197024395 X:121730402-121730424 AAAACTCTTAAAGCCTTAGGAGG + Intergenic
1197054978 X:122107155-122107177 AAAAATTTTAAAGCACTTGATGG + Intergenic
1197138622 X:123091751-123091773 AAAACTTTTAAAATATTTGGAGG - Intergenic
1197857611 X:130933534-130933556 AAGGGATTTAAAGCATATGGGGG - Intergenic
1197931371 X:131699578-131699600 AAAACAGGTTAAGAATTTGGGGG + Intergenic
1198165776 X:134054891-134054913 TAAACTTTGAAAGCATTTTGTGG - Intergenic
1198226242 X:134648389-134648411 AAAACATTTAAAAAACGTGGAGG + Intronic
1198501322 X:137250986-137251008 AAAACATTTTAAGTATTTCCAGG + Intergenic
1198847420 X:140927138-140927160 AAAACATTAAAACAATTAGGAGG + Intergenic
1198974595 X:142322019-142322041 ACAGCATTTAAGGCACTTGGTGG + Intergenic
1199407880 X:147484273-147484295 AAAACATTTAAGGCAGCTAGAGG - Intergenic
1199589503 X:149453732-149453754 AAAACATTTGACACATTAGGTGG + Intergenic
1200131713 X:153852232-153852254 AAAACATTCAAAGCAGCTGGTGG - Intergenic
1200695945 Y:6359609-6359631 AAAACAGTGAAAGCATTTTCTGG - Intergenic
1201023649 Y:9683830-9683852 AAAACAGTGAAAGCATTTTCTGG - Intergenic
1201039332 Y:9815097-9815119 AAAACAGTGAAAGCATTTTCTGG + Intergenic
1201731518 Y:17209812-17209834 AAAACATCTAATGCATTTTTTGG - Intergenic
1202183935 Y:22164719-22164741 AAAACAGTGAAAGCATTTTCTGG + Intergenic
1202207424 Y:22421682-22421704 AAAACAGTGAAAGCATTTTCTGG - Intergenic
1202297482 Y:23375727-23375749 AATACATTCAAAGTGTTTGGGGG - Intergenic
1202573327 Y:26294870-26294892 AATACATTCAAAGTGTTTGGGGG + Intergenic