ID: 993462730

View in Genome Browser
Species Human (GRCh38)
Location 5:88204418-88204440
Sequence ATAAAAACATTTAAAGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1021
Summary {0: 1, 1: 0, 2: 5, 3: 108, 4: 907}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993462730_993462738 25 Left 993462730 5:88204418-88204440 CCAAATGCTTTAAATGTTTTTAT 0: 1
1: 0
2: 5
3: 108
4: 907
Right 993462738 5:88204466-88204488 TGGGTAAACCATCGGATGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 69
993462730_993462735 17 Left 993462730 5:88204418-88204440 CCAAATGCTTTAAATGTTTTTAT 0: 1
1: 0
2: 5
3: 108
4: 907
Right 993462735 5:88204458-88204480 CCACAGACTGGGTAAACCATCGG 0: 1
1: 0
2: 0
3: 7
4: 93
993462730_993462736 23 Left 993462730 5:88204418-88204440 CCAAATGCTTTAAATGTTTTTAT 0: 1
1: 0
2: 5
3: 108
4: 907
Right 993462736 5:88204464-88204486 ACTGGGTAAACCATCGGATGTGG 0: 1
1: 0
2: 0
3: 3
4: 50
993462730_993462737 24 Left 993462730 5:88204418-88204440 CCAAATGCTTTAAATGTTTTTAT 0: 1
1: 0
2: 5
3: 108
4: 907
Right 993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG 0: 1
1: 0
2: 0
3: 2
4: 63
993462730_993462731 5 Left 993462730 5:88204418-88204440 CCAAATGCTTTAAATGTTTTTAT 0: 1
1: 0
2: 5
3: 108
4: 907
Right 993462731 5:88204446-88204468 GATTCTTTCATCCCACAGACTGG 0: 1
1: 0
2: 1
3: 8
4: 166
993462730_993462732 6 Left 993462730 5:88204418-88204440 CCAAATGCTTTAAATGTTTTTAT 0: 1
1: 0
2: 5
3: 108
4: 907
Right 993462732 5:88204447-88204469 ATTCTTTCATCCCACAGACTGGG 0: 1
1: 0
2: 0
3: 21
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993462730 Original CRISPR ATAAAAACATTTAAAGCATT TGG (reversed) Intronic
902644182 1:17786857-17786879 AAAAAAACATTTAAAAAAATAGG - Intronic
903437665 1:23363875-23363897 ACAAAAAAATTTAAAAAATTAGG + Intronic
903914971 1:26757000-26757022 ATAAAAACATTTCAGATATTGGG - Intronic
904524930 1:31126097-31126119 ATTAAAATGTTTAAAGTATTAGG - Intergenic
906029323 1:42705147-42705169 ATAAAAATATATAAAGTCTTAGG + Intergenic
906440169 1:45835892-45835914 AGAAAAATCTTGAAAGCATTGGG - Intronic
906450678 1:45944381-45944403 ATAAAAAAATTTAAAGTAGTTGG - Intronic
906934747 1:50203781-50203803 ATAAACACATTTAAAAATTTGGG - Intronic
906980761 1:50626125-50626147 ATAACAAAATTTAAGGAATTGGG - Intronic
907060593 1:51419405-51419427 AAAAAAAAAATTAAAGCTTTTGG + Intronic
907101190 1:51837402-51837424 ATAAACTCAGTTAAAACATTGGG + Intronic
907454018 1:54563757-54563779 AAAATAACATTTAAAAAATTGGG + Intronic
907679470 1:56550237-56550259 ATAACAAAATGTAAGGCATTCGG + Intronic
907690624 1:56661187-56661209 ATAAAAACGTTAAGAACATTTGG - Intronic
907737869 1:57132913-57132935 ATAAAATCATTTATAAAATTTGG + Intronic
908087094 1:60647055-60647077 AAAAAATTAATTAAAGCATTGGG + Intergenic
908137379 1:61147140-61147162 AAAAAAAGATTTAAAGAATCAGG - Intronic
908144367 1:61223062-61223084 ATACACAGATTTAAAGCATATGG - Intronic
908230399 1:62098798-62098820 TTTAAAATTTTTAAAGCATTTGG + Intronic
908283883 1:62572354-62572376 ATAATAACATGGAGAGCATTTGG - Intronic
908455604 1:64301810-64301832 ATAAATACAGAAAAAGCATTTGG + Intergenic
908982707 1:69978036-69978058 AAAAAAACAAAAAAAGCATTGGG + Intronic
909005653 1:70273280-70273302 TTAAAAAAAATTAATGCATTAGG + Intronic
909280194 1:73741596-73741618 AGAAAATAATTTAAAGGATTTGG + Intergenic
909512578 1:76471359-76471381 ATAAGAACATAGTAAGCATTTGG - Intronic
909797854 1:79765685-79765707 ATAAAATTTTTTAAAGCCTTGGG - Intergenic
910496715 1:87837698-87837720 ATAAAAACATTAAAATAACTTGG + Intergenic
910574723 1:88748066-88748088 ATAAAAAGAATTCAAGTATTAGG - Intronic
911200910 1:95042956-95042978 AGAAAAAGATTAAAAGCATAAGG - Intronic
911422773 1:97665291-97665313 ATATAAACATTTTAAGTATATGG - Intronic
911541951 1:99167025-99167047 ATGAAAACATTGAAACAATTTGG - Intergenic
911836621 1:102627329-102627351 AGAAAAGCATTTAGAGAATTTGG - Intergenic
911847721 1:102775639-102775661 ATAATAACATTAAAAGGTTTTGG + Intergenic
911884158 1:103276207-103276229 TTAAAATAATTTAGAGCATTTGG + Intergenic
911991313 1:104700258-104700280 ATTAAAACATTTTAGGAATTTGG - Intergenic
912027960 1:105203256-105203278 ATGAAAACATGTAAACCATTTGG - Intergenic
912238309 1:107876990-107877012 ATTAATACATTTGAAACATTTGG + Intronic
913428114 1:118757497-118757519 TAAAAAACATTTGCAGCATTGGG - Intergenic
914051290 1:144135440-144135462 ATAAACACAATAAAAGCGTTTGG + Intergenic
914127891 1:144830002-144830024 ATAAACACAATAAAAGCGTTTGG - Intergenic
914335660 1:146712985-146713007 ATGAAAACATTTCAAGTATATGG - Intergenic
914372829 1:147045148-147045170 ATGAAAACAATGATAGCATTAGG + Intergenic
914897542 1:151690359-151690381 AAAAAAACTTTTAAAGTATCTGG - Intronic
915176627 1:154020920-154020942 ATAAAATCATAGAAAACATTTGG - Intronic
915214765 1:154332561-154332583 AAAAAAACATTTAGAGGATGAGG + Intronic
915501926 1:156325110-156325132 ATAGTAATATTTAAAGCATCTGG + Intronic
915922894 1:159990419-159990441 ATAAAAACCTTTAAACAATGAGG - Intergenic
916260925 1:162841374-162841396 ATCTATACATTTACAGCATTGGG + Intronic
916583124 1:166126132-166126154 ATAAAAAAATTGAAAGTAATAGG - Intronic
916668898 1:166993844-166993866 ATGAAAACTGTTAAAGAATTTGG - Intronic
917364408 1:174213800-174213822 ATAAAAACCCTTAAAGAACTGGG + Intronic
918113590 1:181479097-181479119 AGAAAAACATGTGGAGCATTTGG + Intronic
918222819 1:182451488-182451510 AAGAAAACATTTGAAGCAATGGG + Intronic
918474687 1:184911367-184911389 AGAAAGACAGTAAAAGCATTTGG + Intronic
918787760 1:188786445-188786467 ATAATAATATTTAAAGGATAAGG - Intergenic
918808916 1:189090247-189090269 ATAAAAACATTTCAAAGACTAGG + Intergenic
918932238 1:190869095-190869117 TTAAAAACAGTAAAAGCATACGG - Intergenic
918984478 1:191606261-191606283 ATAATATTATTTAAAACATTTGG + Intergenic
919483992 1:198123351-198123373 ATACAAAAATTTAAAGCATCTGG - Intergenic
919716417 1:200782138-200782160 CTAAAAATCTTTAGAGCATTGGG + Intronic
919861763 1:201743634-201743656 AAAAAAAAATCTAAAGAATTTGG - Intronic
921487442 1:215732026-215732048 ATTAAAACATAAAAATCATTGGG + Intronic
921559932 1:216644901-216644923 ATAAAAATATTGACAGCAGTAGG - Intronic
921563122 1:216682412-216682434 AAATAAATTTTTAAAGCATTTGG - Intronic
921567628 1:216739113-216739135 AAGAAAACATTAATAGCATTTGG - Intronic
922526029 1:226304890-226304912 ACAAAAAGATTTAAAGAATATGG + Intronic
923151584 1:231238187-231238209 AAAAAAAAATTAAAAACATTTGG + Intronic
923378608 1:233391916-233391938 ACAAACACATTTAAAGCGTCTGG - Intergenic
924177564 1:241408151-241408173 TTGAAAACATTTAAAATATTGGG - Intergenic
1063666636 10:8064873-8064895 TTAAAAACTTTTTAAGCATGAGG + Intronic
1063760931 10:9075524-9075546 ATAAAAACATTTCAAGTGTGAGG + Intergenic
1063979572 10:11442840-11442862 TTGAGAACTTTTAAAGCATTTGG - Intergenic
1064018360 10:11790274-11790296 TTAAAAAAATTTAAAGCAGCAGG - Intergenic
1064129121 10:12692095-12692117 AGAAAAACAATTCAACCATTTGG - Intronic
1064423007 10:15206387-15206409 AAAAAAAATATTAAAGCATTTGG - Intergenic
1064457099 10:15498018-15498040 TTAAAAGAATTTAAAGCATGGGG - Intergenic
1064537351 10:16371016-16371038 AAAAAAACATGAAAAGCAGTTGG + Intergenic
1064619169 10:17197107-17197129 AAAAAAAAATTAAAAACATTTGG - Intronic
1064624095 10:17244491-17244513 ATAAAAACAACTATAGTATTTGG - Intergenic
1064772589 10:18738825-18738847 CTAAAAAAAATTAAAGAATTAGG + Intergenic
1064814713 10:19246512-19246534 AGAAATCCCTTTAAAGCATTAGG - Intronic
1065309946 10:24405566-24405588 ATAAAAATATTTCAAGTATATGG - Intronic
1065476248 10:26140893-26140915 ACATATACATTTAAAGCATAAGG - Intronic
1065479597 10:26178775-26178797 AAATAAACATTTAAAGCAGAAGG - Intronic
1065759224 10:28966437-28966459 ACAAAAACATTTAAAAAAATTGG + Intergenic
1065953101 10:30669481-30669503 ATAAAATCATTAAAAGAAATTGG - Intergenic
1065993424 10:31033952-31033974 GTAAAAACATTTGATACATTTGG - Intergenic
1066119595 10:32271997-32272019 ATAAAGACATTTAAATTGTTTGG - Intronic
1066146690 10:32566608-32566630 AGATAAACATTTAAAAAATTTGG + Intronic
1066167751 10:32806656-32806678 ATTAAAAAACTTAAAGTATTAGG + Intronic
1066329943 10:34410495-34410517 ATAAAAACATTTCAATATTTAGG + Intronic
1066760640 10:38747855-38747877 ATAAACACAATAAAAGCGTTTGG - Intergenic
1066960935 10:42224561-42224583 ATAAACACAATAAAAGCGTTTGG + Intergenic
1067835407 10:49635693-49635715 ATCAATACAGTAAAAGCATTTGG + Intronic
1067940978 10:50655908-50655930 ATACAAAAATTTAAAGCAGTAGG + Intergenic
1068173386 10:53424554-53424576 CTAAAAAAATTTAGAGGATTAGG + Intergenic
1068183570 10:53555126-53555148 TTTAAAATATTTTAAGCATTAGG + Intergenic
1068452197 10:57206004-57206026 TTTAATACATTTAAAGCAGTTGG + Intergenic
1068649498 10:59506031-59506053 TTAAAAAGAATTAAAGTATTGGG + Intergenic
1068651418 10:59526990-59527012 ATATTAACATTTAAAACACTTGG + Intergenic
1069440940 10:68427480-68427502 ATAAAAAAATTGAAAATATTAGG + Intronic
1070373970 10:75811110-75811132 ATAAATACATTTAAAATATTTGG + Intronic
1070533754 10:77360181-77360203 AGAAAAATATATAAAGCAATAGG + Intronic
1070862194 10:79680754-79680776 ATAGAAAAATTTAAAGCAGTAGG + Intergenic
1070868663 10:79727964-79727986 ATAAAAACATTTGATGATTTGGG + Intergenic
1071013005 10:80961007-80961029 AGAAAAATATTTAAAGTATGAGG - Intergenic
1071074470 10:81734221-81734243 AAAAAAACTTTTAAAGAAATTGG + Intergenic
1071223515 10:83498091-83498113 ATAAATAAAATTAAATCATTTGG + Intergenic
1071371322 10:84954452-84954474 GAAAATACATGTAAAGCATTTGG - Intergenic
1071389771 10:85160785-85160807 ATAAAAAGATATAAATCATCTGG - Intergenic
1071542347 10:86497978-86498000 AGCAAAAAATTTTAAGCATTGGG - Intronic
1071635577 10:87250179-87250201 ATAAAAACATTTGATGATTTGGG + Intergenic
1071659662 10:87487795-87487817 ATAAAAACATTTGATGATTTGGG - Intergenic
1071779582 10:88828444-88828466 ATAAAAACAAAAAAAGCCTTTGG - Intronic
1071804383 10:89101149-89101171 AAAAAAACATAAAAAGCATGCGG - Intergenic
1071996649 10:91155829-91155851 ATACAAAAACTTAAAACATTTGG + Intergenic
1074266689 10:111911250-111911272 AAAAACACACTGAAAGCATTGGG + Intergenic
1074328900 10:112483156-112483178 AAAAAGACATTAAAAGCATCTGG - Intronic
1074657311 10:115606802-115606824 ATAAACTGATTTAAAGCATTTGG - Intronic
1074810504 10:117100208-117100230 GTAAATACATGTAAAGCATCTGG + Intronic
1074829474 10:117238819-117238841 ATTTAAACAATAAAAGCATTAGG + Intergenic
1076457965 10:130616009-130616031 ATAAAAATATTTAAAACAGCTGG - Intergenic
1076561366 10:131367358-131367380 ATTAAAAGATATACAGCATTTGG - Intergenic
1077862134 11:6191466-6191488 TTAAATACATTTAAATGATTTGG + Intergenic
1078051415 11:7968068-7968090 AGAAAAACATGTGAAGCAATTGG + Intergenic
1078097192 11:8307146-8307168 ATAAAACAATTTAAAAAATTGGG + Intergenic
1078129397 11:8600876-8600898 ATTAAAATACATAAAGCATTTGG - Intergenic
1078323648 11:10359634-10359656 CTAATAACATATATAGCATTTGG - Intronic
1078399260 11:11009803-11009825 AAACAAACATTTAAATCATTTGG - Intergenic
1078905379 11:15682840-15682862 AGAAAAATATTTAAAACCTTGGG + Intergenic
1079765499 11:24387379-24387401 AAAAAAACATTAAAAGCAATGGG - Intergenic
1079853898 11:25575417-25575439 AAATAAACATTTAAAACACTTGG + Intergenic
1080082669 11:28238933-28238955 ATAAAATCATTTGAAGGAATAGG - Intronic
1080166752 11:29246311-29246333 GTAAAAATATTTAAAGAGTTGGG + Intergenic
1080254990 11:30280708-30280730 AATAATACATATAAAGCATTTGG - Intergenic
1080545438 11:33312807-33312829 ATAAAACCAAGTAAAGCACTTGG - Intronic
1080793536 11:35542132-35542154 TTAAAAACATGTCAAGAATTAGG - Intergenic
1081266406 11:41028759-41028781 AAAAAAACATTCCAAGCATAAGG - Intronic
1081318207 11:41657678-41657700 ATAAAATTATTGAAGGCATTTGG - Intergenic
1083063196 11:59896341-59896363 TTAAAAACATATGAAGCACTGGG - Intergenic
1083350363 11:62024067-62024089 AGATGAACATTAAAAGCATTAGG + Intergenic
1084909340 11:72375117-72375139 AAAAAAACATTTAAAATATCTGG - Intronic
1085196544 11:74675749-74675771 AATAATACATCTAAAGCATTTGG - Intergenic
1085842418 11:80027897-80027919 ATAAAAAAATTTAAAGAGTAAGG + Intergenic
1085886052 11:80523447-80523469 AAACAAACATGTAAAGCATCAGG + Intergenic
1085926143 11:81024157-81024179 TTAAAAACATGTAAAGAATCTGG + Intergenic
1086052854 11:82614522-82614544 ATAAAAATATATAAATCAATTGG + Intergenic
1086387303 11:86322343-86322365 TTAAAAACATGTAAACGATTTGG - Intronic
1086785448 11:90964448-90964470 TTAAAATGATTTAAAGCATATGG + Intergenic
1086862860 11:91945622-91945644 AAAAAAAAAATTAAAGCATTTGG + Intergenic
1086890661 11:92254523-92254545 ATTAAAACTTTCAAATCATTAGG + Intergenic
1087227827 11:95623747-95623769 ATAAAAACTCTTAACGGATTAGG + Intergenic
1087541015 11:99520034-99520056 ATAAAAACATTTAAATATTCTGG - Intronic
1087565419 11:99850435-99850457 ATAAAATTATATATAGCATTTGG + Intronic
1088162754 11:106893386-106893408 AAAAAAAAACTTAAAGGATTGGG + Intronic
1090129001 11:124119448-124119470 AGAAAACCTTTTAAAGCATGAGG - Intronic
1090542045 11:127717156-127717178 ATTAAAACATTTAAATCAAGTGG + Intergenic
1090610772 11:128468364-128468386 ATAAATACATATATAGCAATGGG + Intronic
1090898545 11:131003995-131004017 ATAAAAACATATAAAACAAAGGG - Intergenic
1091483989 12:866041-866063 ATAAAATTATTTTAAGCATGTGG + Intronic
1091987345 12:4922065-4922087 ATAGAGATAATTAAAGCATTTGG - Intronic
1092446353 12:8561082-8561104 ATAAACAGTGTTAAAGCATTAGG + Intergenic
1092568323 12:9693783-9693805 AAAAAACCATTTTAAGAATTAGG - Intronic
1092655785 12:10683693-10683715 ACAAAAACATTTAAATAATTGGG + Intergenic
1093191396 12:16079000-16079022 TTAAACACATTTGAAGCATAAGG + Intergenic
1093545223 12:20337611-20337633 AGAAAAAAAGTTAAAACATTTGG - Intergenic
1093726283 12:22513485-22513507 ATCGAAACATTTAAAGCACTGGG + Intronic
1093919900 12:24848182-24848204 ATAAAAATATTTGATTCATTAGG - Intronic
1093972736 12:25390020-25390042 ATAAAAATATTTCAAGGCTTGGG + Intergenic
1094342556 12:29429228-29429250 ATAAAATCCTTTAAAACATATGG + Intronic
1094381215 12:29845241-29845263 ATAAATATATGTAAAGCACTTGG - Intergenic
1094591637 12:31827211-31827233 ATAAAAACTTTTAAAAAATCAGG + Intergenic
1094620038 12:32072132-32072154 ATAATAACATTTAAATAATGAGG + Intergenic
1094740950 12:33288045-33288067 ATAAAAACATTTATTACTTTTGG + Intergenic
1095157277 12:38872877-38872899 ATAAAAACAATTCAATCTTTGGG + Intronic
1096163640 12:49402169-49402191 ACAAAAACATTTAGGACATTCGG - Intronic
1097251360 12:57633924-57633946 ATTAAAATATTTAATACATTTGG - Intergenic
1097439708 12:59595059-59595081 ATAAAAAGAGTTAAGTCATTTGG - Intergenic
1097479111 12:60098932-60098954 GTCAAAATATTTAAAGCATTGGG + Intergenic
1097517835 12:60627669-60627691 ATTAAAACAATGAAAGCCTTTGG + Intergenic
1098079612 12:66770115-66770137 ACTAAAACATATAAAGCATTTGG + Intronic
1098471666 12:70852150-70852172 AAAAAAATTTTTAAAGCATCTGG - Intronic
1098656850 12:73042042-73042064 AGAAAAGCATTTAAAACATGAGG - Intergenic
1098728831 12:74006208-74006230 ATAAAAACACTCAAAAAATTGGG + Intergenic
1098750627 12:74289714-74289736 ATAAAAATTTTTGAAGCAGTTGG + Intergenic
1099325008 12:81203837-81203859 ATAAAAAGATTAAAAACATCTGG + Intronic
1099543600 12:83947390-83947412 CTAAAAAAATTTAAAGCATAAGG + Intergenic
1099623738 12:85038946-85038968 ATAAAAAGATGTGAAGAATTTGG - Intronic
1099767069 12:86999978-87000000 ATATAAACAGTTAAATAATTAGG + Intergenic
1099922310 12:88974029-88974051 CTAAATACATTTAAATCAATGGG - Intergenic
1099980020 12:89588421-89588443 ATACAAAGATTAAAAACATTTGG + Exonic
1100030222 12:90178387-90178409 ATAAAAATATCTAAAGCATAGGG + Intergenic
1100088677 12:90942726-90942748 TTAAAATCATTTAAATTATTTGG + Intronic
1100160472 12:91854602-91854624 AAATAAACATTTAAAAAATTGGG + Intergenic
1100213664 12:92425580-92425602 AGAAATCCATTCAAAGCATTCGG + Exonic
1100250349 12:92814990-92815012 ATAATATCACTTAAAGCACTAGG + Intronic
1100727709 12:97426610-97426632 ATTAACACATGTAAAGCACTTGG - Intergenic
1100811960 12:98347389-98347411 ATAATTATATTTAAAGCATGGGG - Intergenic
1101086016 12:101237265-101237287 ATATAAACTTATAAAGCCTTTGG + Intergenic
1101108832 12:101466160-101466182 ATAAAAATGTATAAAGAATTTGG + Intergenic
1101623250 12:106411436-106411458 CTATTAACATTTAAAGAATTAGG - Intronic
1101671197 12:106875223-106875245 ATATAAACATTTAAGGCCTGAGG + Intronic
1101923337 12:108951005-108951027 ATAATCACATTTACAGCACTGGG + Intronic
1102621704 12:114201222-114201244 ATAAAAGCATTTAACTCATGTGG - Intergenic
1103153654 12:118664090-118664112 ATTGAAACATTTCAAACATTAGG + Intergenic
1104248178 12:127062732-127062754 TGAAAAACATATAAAGCTTTGGG - Intergenic
1105961397 13:25344375-25344397 ATAATATAATCTAAAGCATTTGG + Intronic
1106317845 13:28610804-28610826 AGAAAACCATTGAAAGCATAAGG - Intergenic
1106772610 13:32976406-32976428 TTACAAAGATTAAAAGCATTGGG + Intergenic
1106878162 13:34098830-34098852 ATAAAAATATTAAGAGAATTTGG + Intergenic
1107223397 13:38015252-38015274 ATAAAAACTCTTCTAGCATTTGG + Intergenic
1107249663 13:38343893-38343915 ATAATAAAATACAAAGCATTCGG - Intergenic
1108103199 13:46980005-46980027 ATAAAAACATTTGAAAAAATAGG + Intergenic
1108305667 13:49129733-49129755 TTAAAAACAGTTAATTCATTTGG + Intronic
1108468743 13:50746524-50746546 ATAAAGACATTTTGAACATTTGG + Intronic
1108757231 13:53518420-53518442 GTTAAAACATATAAAGAATTTGG + Intergenic
1108806726 13:54166566-54166588 ATAAAAATATGAAAAGCATGTGG + Intergenic
1108839160 13:54591565-54591587 ATACATACATTTAAATTATTGGG + Intergenic
1109013367 13:56977367-56977389 ATAATTATATTTAATGCATTTGG - Intergenic
1109036736 13:57272213-57272235 ATAAAAATATTCAAATTATTTGG + Intergenic
1109477372 13:62899208-62899230 ATAAATACATCTAAAGTAATTGG - Intergenic
1110235642 13:73215048-73215070 ATCAAAAGATTTGAAGCTTTAGG - Intergenic
1110300786 13:73924390-73924412 ATGAAAACATTTGAAATATTGGG - Intronic
1110303801 13:73960925-73960947 ATAAATAAAATTAAAGTATTTGG - Intronic
1110362645 13:74644541-74644563 ATTAAAACATTTACAGCAAAAGG - Intergenic
1111003158 13:82211958-82211980 ATAATTATATTTAAAGTATTGGG + Intergenic
1111021008 13:82452061-82452083 ATAAAAACTTTTGAAAAATTGGG - Intergenic
1111025970 13:82524893-82524915 ATTAACACATTTAAAGCACATGG + Intergenic
1111050424 13:82876698-82876720 AAAAAAACATTTTAAGCAGTAGG - Intergenic
1112189992 13:97167111-97167133 ATAAATAAATGTAAAGAATTAGG + Intergenic
1112283804 13:98086038-98086060 AAAAAAAAATTCAAAGAATTGGG + Intergenic
1112758763 13:102670139-102670161 ATAAAAAGCATTAAAGAATTAGG + Intronic
1112966786 13:105206963-105206985 ATAAAAAGATTTTAAAAATTAGG - Intergenic
1113126511 13:106985069-106985091 ATGAAAACATTGAAAGAAATAGG - Intergenic
1114365452 14:22022191-22022213 ATAAACCATTTTAAAGCATTGGG - Intergenic
1114368390 14:22056056-22056078 ATAAAAACCTTTAACAAATTAGG + Intergenic
1114848006 14:26347464-26347486 CTAAAAACAGTTAAATCAGTTGG - Intergenic
1114998517 14:28391246-28391268 AAAAAATCAATTAAAACATTTGG - Intergenic
1115049172 14:29035541-29035563 ATCAAATCATTTATAGCTTTAGG + Intergenic
1115150902 14:30284120-30284142 ATAAACAAGTTGAAAGCATTGGG - Intergenic
1115358581 14:32476244-32476266 ATAAAAACTTTAAGAGCATGAGG - Intronic
1115833228 14:37365389-37365411 ATAAAAACACTCAAAAAATTGGG - Intronic
1115882445 14:37934854-37934876 ATAAATACATTTAAAAAATGAGG + Intronic
1115902797 14:38172491-38172513 ATTTAAATATCTAAAGCATTTGG - Intergenic
1116342502 14:43742350-43742372 TTAAAAAAATTAAAAGCATAAGG - Intergenic
1116659487 14:47690525-47690547 ATAAAAACACTGAAAGAATCTGG - Intergenic
1116705397 14:48290947-48290969 ATTAAAATATTTAAAATATTTGG - Intergenic
1116956610 14:50930252-50930274 ATAAAAACATGTAAAATATCTGG - Intronic
1117854453 14:60013113-60013135 TTAAAAACATATTAAGCCTTGGG - Intronic
1119115508 14:72017196-72017218 ATAAAAAAATTTAAATCAGCTGG - Intronic
1119261246 14:73239306-73239328 ATTAACACTTTTAGAGCATTTGG + Intronic
1119553758 14:75537756-75537778 ATTAAAAAATTTAAAGAGTTGGG - Intronic
1119604111 14:75999802-75999824 GTAAAACCATTTAATGTATTGGG + Intronic
1120436789 14:84492805-84492827 ATAGAGACATTTAAGGGATTTGG - Intergenic
1120782667 14:88499762-88499784 ATAAAAACAATATAAGCTTTTGG + Intronic
1120804039 14:88726079-88726101 TTAGAAAAATTTAAAGAATTTGG - Intronic
1122701649 14:103593583-103593605 ATTAAAATATTTAAAATATTTGG - Intronic
1122735561 14:103838143-103838165 ATAACAACAATAAAAACATTTGG + Intronic
1123421065 15:20133948-20133970 ATAAACACAATAAAAGCGTTTGG + Intergenic
1123444696 15:20318750-20318772 ATAAACACAATAAAAGCATTTGG - Intergenic
1123530289 15:21140477-21140499 ATAAACACAATAAAAGCGTTTGG + Intergenic
1123683451 15:22780699-22780721 TTAAAAACATTTTAAAAATTAGG + Intronic
1124114062 15:26823456-26823478 ATAAACATATCTGAAGCATTTGG + Intronic
1124194969 15:27616945-27616967 ATATAAATATTTAAAGCACAGGG + Intergenic
1124335661 15:28855109-28855131 TTAAAAACATTTTAAAAATTGGG + Intergenic
1124605373 15:31166201-31166223 ATATAACCATTTAAAACAGTTGG + Intergenic
1125269285 15:37920808-37920830 ATAAAAACATTAAAAACTTCAGG - Intergenic
1125437799 15:39666485-39666507 ATGAAAAAATTTAAACAATTGGG - Intronic
1125910892 15:43437870-43437892 AGAAAAAGATTTACAGGATTTGG + Intronic
1125973637 15:43932612-43932634 ATAAAAAGAAAAAAAGCATTTGG + Intronic
1126243164 15:46468851-46468873 ACATAATTATTTAAAGCATTTGG + Intergenic
1126279050 15:46921646-46921668 GTAAATTCATTTAAAGCAATAGG - Intergenic
1126418566 15:48445898-48445920 ACAATAAAATTTAAAGAATTTGG + Intronic
1126844912 15:52750154-52750176 ACAAAAACGTGTAATGCATTAGG - Intergenic
1126958571 15:53963313-53963335 ATAAAAACATTTTCAGGTTTAGG + Intergenic
1127005873 15:54569671-54569693 ATGAAAACATTAAAAACATATGG + Intronic
1127144634 15:56011797-56011819 ATAAAAACTTTTATATCCTTTGG + Intergenic
1127402657 15:58605290-58605312 ACTAAAACATCTCAAGCATTGGG - Intronic
1127449012 15:59098674-59098696 ATAACAACAGATAAAGCTTTGGG - Intergenic
1127663162 15:61119360-61119382 AAAAAAAAATTTAAAACCTTAGG - Intronic
1129434505 15:75527575-75527597 ATAAAAAAATTTAAAAATTTTGG + Intronic
1129646863 15:77443649-77443671 ATCAAAATATTCAAAGTATTGGG - Intronic
1130057400 15:80538606-80538628 ATAAAAACATTTTAAGCCACAGG - Intronic
1130328600 15:82901798-82901820 GGAAAAACATTAAAAGCATTTGG + Intronic
1130717841 15:86353603-86353625 ATAAAATCATTTGAAGAATAAGG + Intronic
1131594479 15:93782967-93782989 GTATTAACATTTAAATCATTAGG - Intergenic
1131742391 15:95407834-95407856 ATAAAAACATGGAAAGTATGAGG - Intergenic
1131785993 15:95911835-95911857 TCAAAGACCTTTAAAGCATTGGG + Intergenic
1131805970 15:96123038-96123060 TTAAAAACATTAAAAGTTTTTGG + Intergenic
1133068829 16:3231922-3231944 ATAAACACATGAAAAGCATTTGG + Intronic
1133397015 16:5455922-5455944 ATAAAAACACTGGAAGCCTTAGG - Intergenic
1133485656 16:6215822-6215844 ATAAACACATTCAACCCATTGGG - Intronic
1134278009 16:12793608-12793630 CTTAAAACATGTAAAGCATTTGG + Intronic
1134882388 16:17757049-17757071 ATGAACACATGTAAAGCATTTGG - Intergenic
1135094110 16:19549191-19549213 CTAAAAAATATTAAAGCATTTGG - Intronic
1135227154 16:20670903-20670925 ATTAAAAAATATAAAGAATTTGG + Intronic
1135918522 16:26627038-26627060 ATGACAACATTTAAAGAATAGGG + Intergenic
1136722125 16:32330172-32330194 ATAAACACAATAAAAGCATTTGG + Intergenic
1136840449 16:33536139-33536161 ATAAACACAATAAAAGCATTTGG + Intergenic
1137858253 16:51818668-51818690 AAGAAAACTTTCAAAGCATTTGG + Intergenic
1137957709 16:52849373-52849395 ATAAAAACTTTTGAAACACTAGG - Intergenic
1138466397 16:57194993-57195015 TTAAAAAAATATAAAGCGTTAGG + Intronic
1138851994 16:60640831-60640853 ATAAATAAATTTAAAACATAAGG - Intergenic
1138893572 16:61175396-61175418 ATAAATACATAGAAAACATTTGG + Intergenic
1139055847 16:63182428-63182450 ATGAAAACATTAAAAAAATTGGG - Intergenic
1139694869 16:68666732-68666754 ATAAAGCCATTTATAGCATAAGG - Intronic
1139811678 16:69624148-69624170 AGATGAACATTTCAAGCATTAGG + Intronic
1139997965 16:70998243-70998265 ATGAAAACATTTCAAGTATATGG + Intronic
1140213005 16:72985596-72985618 ATTAAAACAATTATAGCAGTGGG - Intronic
1140338209 16:74131664-74131686 AAAAAAACAATTAAAGTTTTGGG + Intergenic
1140801188 16:78489900-78489922 ATATAAACATTAAAATCATCCGG - Intronic
1203004306 16_KI270728v1_random:187602-187624 ATAAACACAATAAAAGCATTTGG - Intergenic
1203135916 16_KI270728v1_random:1724020-1724042 ATAAACACAATAAAAGCATTTGG - Intergenic
1203150615 16_KI270728v1_random:1836432-1836454 ATAAACACAATAAAAGCATTTGG + Intergenic
1143059845 17:4190598-4190620 ACAAACATATTTAAAGCATTAGG - Intronic
1143230109 17:5346332-5346354 TTTTATACATTTAAAGCATTTGG + Intronic
1143238591 17:5424291-5424313 ACAAAAAAATTTAAAAAATTAGG - Intronic
1143885387 17:10061330-10061352 ATAAACAGAATTACAGCATTGGG + Intronic
1144440621 17:15278124-15278146 ATAAAAAAAATTAAAGCAAGGGG - Intergenic
1145368604 17:22287785-22287807 ATAAACACAATGAAAGCATTTGG - Intergenic
1145803506 17:27707959-27707981 ATAAAAACTTTTTAAAAATTTGG - Intergenic
1146465766 17:33084952-33084974 AAAATAAAATTTAAAACATTTGG + Intronic
1146941827 17:36848619-36848641 ATAAAAAAATCAAAAGCACTGGG - Intergenic
1147695016 17:42345309-42345331 AACAAAACTTTTAAACCATTGGG + Intronic
1148024991 17:44580915-44580937 ATAAATATATATAAAGCACTTGG - Intergenic
1148172390 17:45533350-45533372 ATAAAAACATTCATATCATTTGG - Intergenic
1148276879 17:46312102-46312124 ATAAAAACATTCATATCATTTGG + Intronic
1148298993 17:46529686-46529708 ATAAAAACACTCATATCATTTGG + Intronic
1148363533 17:47034213-47034235 ATAAAAACATTCATATCATTTGG + Intronic
1148517678 17:48236546-48236568 ATAAACAAATTTAAAGTACTTGG + Intronic
1149010495 17:51851497-51851519 ATTAATACATGTAAAGCATTTGG + Intronic
1149082147 17:52671143-52671165 ATAAAAAATCTTAAAGTATTAGG + Intergenic
1149176154 17:53873173-53873195 AGAAAGATATTTAAAGAATTAGG + Intergenic
1149246681 17:54716790-54716812 ATAAAAACAATTTAAACTTTGGG + Intergenic
1149625861 17:58080458-58080480 ATACACACATATAAAGCAGTGGG - Intergenic
1149702897 17:58670064-58670086 GTAAAAACATTTTAAGCAAGGGG - Intronic
1149760756 17:59227423-59227445 AAAAAAAAATTTAAAACTTTTGG + Intronic
1149764511 17:59263854-59263876 ATATAAACATTAAAGGAATTGGG + Intronic
1150305651 17:64083050-64083072 AGAAAAACATTTACAGAATTAGG - Intronic
1150403596 17:64880266-64880288 ATAAAAGCATTCATATCATTTGG - Intronic
1150619098 17:66795807-66795829 ATAAAAACATGTACTCCATTTGG - Intronic
1150730765 17:67691345-67691367 ATAAGAACATTTCAGGTATTTGG + Intronic
1151206136 17:72508704-72508726 ATAAACACATTTAAGACTTTTGG - Intergenic
1151243871 17:72779447-72779469 ATAAAAAAATAAAGAGCATTTGG + Intronic
1151289803 17:73141465-73141487 AGAAAAACATTCAAAGACTTGGG - Intergenic
1152459849 17:80436454-80436476 ATAAAAACACTTAACAAATTAGG - Exonic
1152671874 17:81613069-81613091 ATAAAAAATTTTGAAGCATTTGG - Intronic
1153134569 18:1899987-1900009 TCAAAAACATGTGAAGCATTTGG + Intergenic
1153182491 18:2450698-2450720 AAAAAAACAATGAAAGCATGAGG + Intergenic
1153434660 18:5056640-5056662 ATAAAAAAAAGTAAAACATTTGG + Intergenic
1153459541 18:5318323-5318345 AGGAAAACAATTAATGCATTGGG - Intergenic
1153591433 18:6677562-6677584 AAAAAAAGCTTTAAAACATTTGG - Intergenic
1153592228 18:6685635-6685657 ATAAAAACACTGAAAGCCATGGG - Intergenic
1153598133 18:6750162-6750184 TTTAATACATGTAAAGCATTTGG - Intronic
1154063242 18:11083229-11083251 GTTAAAACATTTAAGTCATTTGG - Intronic
1154345123 18:13536660-13536682 ATAAAAGCATTTAAAAAAATAGG + Intronic
1154941819 18:21120864-21120886 ATAAAAATATATTAAGCCTTTGG - Intergenic
1155572295 18:27208687-27208709 ATAAAAAAATGTAAATCTTTGGG - Intergenic
1155604118 18:27584047-27584069 ATGCAAACATTTAAGGCTTTTGG + Intergenic
1155692031 18:28636253-28636275 ATGGACACATTTAAAGCATCTGG + Intergenic
1155791490 18:29976293-29976315 ATAAAAACAATTAAAACTCTAGG - Intergenic
1155814860 18:30294296-30294318 ATAAGAACAATTAAATAATTGGG + Intergenic
1156656376 18:39293250-39293272 ATCAAAATATTTAAAGCAATTGG - Intergenic
1156743394 18:40360263-40360285 ATAAATTCATTTATAGCTTTGGG + Intergenic
1156933551 18:42675143-42675165 TTAATAACATTTAAATCAGTAGG + Intergenic
1157020942 18:43781297-43781319 ATCAACACATTTAAGCCATTTGG - Intergenic
1157140999 18:45106323-45106345 AAAAAAAAATCTGAAGCATTTGG + Intergenic
1157268832 18:46253405-46253427 ATAAAAAAATTTAAATGCTTTGG - Intronic
1157838476 18:50931514-50931536 TTAAACACATATAAAGCACTTGG + Intronic
1157925970 18:51766607-51766629 ATAACTACATTTTAAGCTTTTGG + Intergenic
1158134026 18:54186231-54186253 ATAAAAACATTTATATCTATGGG + Intronic
1158322327 18:56277231-56277253 AGTAATACATTGAAAGCATTTGG + Intergenic
1158438630 18:57453338-57453360 AGGAAAACATTTTAAGCCTTTGG + Intronic
1158744268 18:60180136-60180158 ATATGAACATTTAAAGCTATTGG - Intergenic
1158974160 18:62695441-62695463 AAAAAAACATTCAATGGATTAGG + Intergenic
1159213514 18:65361173-65361195 GTAAAAACTTTTGAATCATTGGG + Intergenic
1159214975 18:65380814-65380836 TTAAAATCATTTGAAGGATTAGG + Intergenic
1159394677 18:67840181-67840203 ATAAATAATTATAAAGCATTAGG + Intergenic
1159777985 18:72625877-72625899 ATAAGAACATCTTCAGCATTTGG - Intronic
1159835774 18:73333304-73333326 ATAAACACATTTACAAGATTAGG + Intergenic
1159906282 18:74095657-74095679 ATGAAAAAGTTTAAAACATTGGG + Intronic
1160108547 18:76003304-76003326 ATACAAACATTACAAACATTTGG + Intergenic
1160277359 18:77449804-77449826 ATCAAAAGATTTAAAATATTAGG + Intergenic
1161763520 19:6192283-6192305 ACAAAAACATTTAAAACATTAGG - Intronic
1164491886 19:28722396-28722418 AAAAAAAGTTTTAAATCATTTGG - Intergenic
1164844594 19:31421071-31421093 AGAAAAAAAATTAAAGCATGTGG - Intergenic
1164848296 19:31454078-31454100 ATAAACACATTGAGAGAATTGGG + Intergenic
1165670145 19:37671343-37671365 ATATAAGCATTTAAAGCTATAGG - Intronic
1166349924 19:42191982-42192004 GTAAACACATGTAAAGCATTTGG + Intronic
1166919522 19:46219706-46219728 AGAAAAACATTAAACGCAGTAGG + Intergenic
1167481716 19:49736268-49736290 ATAAAATAATCTAAAGGATTTGG + Intergenic
1167841405 19:52124493-52124515 ATTAGAACATGTAAAGCATTTGG - Intronic
1167845532 19:52161043-52161065 ATTAGAACATGTAAAGCATTTGG - Intronic
1202690696 1_KI270712v1_random:88076-88098 ATAAACACAATAAAAGCGTTTGG + Intergenic
926497648 2:13611409-13611431 ATAACACCATTTAATACATTTGG - Intergenic
927310773 2:21628821-21628843 GTGAACACATTTAAAGCAATGGG + Intergenic
928056341 2:28059115-28059137 ATAAATACATTTCCAGAATTTGG + Intronic
928139104 2:28712427-28712449 ATTGAAACATATAAAGCCTTTGG - Intergenic
928813832 2:35264275-35264297 ATAAATACATTTACTGCATAAGG + Intergenic
928886367 2:36153092-36153114 ATATAAACATTTAATGAATTAGG + Intergenic
929042246 2:37756507-37756529 ATAAAAACACTAAAAAAATTAGG - Intergenic
929500163 2:42483736-42483758 ATACAAATATTTAAAGAATGGGG + Intronic
930145259 2:47995844-47995866 AAAAATACACGTAAAGCATTTGG + Intergenic
930270346 2:49248885-49248907 ATAAAATCATTTTAAAAATTAGG - Intergenic
930500303 2:52208087-52208109 ATAACCACATTGAAGGCATTGGG + Intergenic
930511311 2:52348984-52349006 ATTAAAACATTGAAAACATGAGG - Intergenic
930851332 2:55964206-55964228 ATTCAAACATTTTAACCATTGGG + Intergenic
930863566 2:56100243-56100265 ATAAAATTATTTCAGGCATTTGG - Intergenic
930938296 2:56982801-56982823 GTAAAAACTGTTAAAGCATTAGG + Intergenic
930949716 2:57125845-57125867 ACAAAAACATATAACGCATTTGG - Intergenic
931015088 2:57967781-57967803 ATAAAAATATTTGAAGGATCAGG + Intronic
931183154 2:59923737-59923759 AACATAACATTTAAAGCTTTCGG - Intergenic
931235362 2:60408107-60408129 TGTAAAACATTTAAATCATTGGG + Intergenic
931681774 2:64755806-64755828 ATAAAAACTTTTATAAGATTAGG + Intergenic
931865510 2:66406155-66406177 ACAAAAAAATATAAAGTATTGGG + Intergenic
932156853 2:69425785-69425807 ATAAATACATGTAAAGCACCTGG - Intronic
932956179 2:76353364-76353386 ATAAAAAGAGAAAAAGCATTGGG + Intergenic
933347069 2:81101525-81101547 ATAATGACACTTAAGGCATTAGG - Intergenic
933382574 2:81568349-81568371 ACAAAGAAATTTAAAGCATAGGG - Intergenic
933955715 2:87367928-87367950 ATAAACACAATAAAAGCGTTTGG - Intergenic
934239867 2:90259961-90259983 ATAAACACAATAAAAGCGTTTGG - Intergenic
934273322 2:91556793-91556815 ATAAACACAATAAAAGCGTTTGG + Intergenic
934323964 2:91992656-91992678 ATAAACACAATAAAAGCATTTGG - Intergenic
934462314 2:94223227-94223249 ATAAACACAATAAAAGCGTTTGG - Intergenic
935093494 2:99919902-99919924 ATACAAAAATTTAAAGTATGAGG + Intronic
935449967 2:103198186-103198208 AATAATACATATAAAGCATTTGG - Intergenic
935510447 2:103965417-103965439 ATAAAAACATGTACAGCTTTGGG + Intergenic
935544014 2:104381463-104381485 ATTAAAAAAATTAAACCATTTGG - Intergenic
936894444 2:117411163-117411185 AGAAAAAGCTTTAAAACATTTGG + Intergenic
936975526 2:118217727-118217749 TTAAATACATGTAAAGCACTTGG + Intergenic
937007092 2:118527069-118527091 ATAACAACATAAAAAGCATCAGG - Intergenic
937499145 2:122459480-122459502 GTGAATACATGTAAAGCATTTGG - Intergenic
937506872 2:122547461-122547483 ATAAGCACATTTAAAACAGTTGG - Intergenic
937781121 2:125838375-125838397 ATAAAAACACTTAGAACCTTAGG - Intergenic
937848838 2:126614153-126614175 ATTTAAATATTTAAAGCATCTGG - Intergenic
938621362 2:133057721-133057743 ATAAAAGCACCTAAAGCACTTGG - Intronic
938881649 2:135595552-135595574 ATTAATACACTTAAAGCATTGGG + Intronic
938886325 2:135652924-135652946 CTAAAAACATTAAAAGCATAAGG - Intronic
939244449 2:139605502-139605524 ATAAAAACCTTCAAAACACTGGG - Intergenic
939252829 2:139705047-139705069 ATTAAAACATTTAAATGATATGG - Intergenic
939369446 2:141279220-141279242 CTATAAACATTTAAAAAATTAGG - Intronic
939750708 2:146041861-146041883 ATAATAATATTTAAAACTTTGGG - Intergenic
940208262 2:151228702-151228724 AAAAAAACATATATAGCATTAGG + Intergenic
940404592 2:153286093-153286115 AAAAAAACATTAAAAGTACTAGG + Intergenic
941179073 2:162235991-162236013 ATAAAAACACTTAACGGATTAGG - Intronic
941319403 2:164035788-164035810 ATAAAATGAATGAAAGCATTTGG + Intergenic
942667957 2:178342061-178342083 ATCAAAACATTTAAAACAGGAGG - Intronic
942905167 2:181171741-181171763 ATAAAAGCAATTAAAGCCTACGG - Intergenic
942990936 2:182201755-182201777 ATAAAACCATTTCAATCACTAGG + Exonic
943251443 2:185525299-185525321 ATAAAAACAGTTAAAAAATTCGG + Intergenic
943298501 2:186168044-186168066 ATAAATTCATCTAAGGCATTAGG + Intergenic
943301493 2:186208077-186208099 ATAAGATAATTTAAATCATTTGG + Intergenic
943427662 2:187756782-187756804 ATAATAACATTGAAAGCAAATGG - Intergenic
943551489 2:189345663-189345685 ATAAAAATATTTATTGGATTTGG + Intergenic
943670156 2:190651352-190651374 AGAGAAACACTGAAAGCATTAGG + Intronic
943753612 2:191535966-191535988 AAAAAAAGATTTAAACTATTTGG - Intergenic
943879039 2:193114661-193114683 ATAAAAAATTTGAAAGCATTTGG + Intergenic
943987071 2:194636825-194636847 ATAAAAACATTCAACAAATTAGG + Intergenic
944037111 2:195308216-195308238 ATAAAATTATTTAAAAGATTAGG - Intergenic
944202631 2:197123977-197123999 GTATATACAGTTAAAGCATTTGG - Intronic
944518524 2:200538607-200538629 ATAAATACATATAAAATATTAGG + Intronic
944531407 2:200671201-200671223 ATAGTAACTTTTAAAGCTTTTGG - Exonic
944617272 2:201474189-201474211 ATATAAATATTTTAAGAATTGGG - Intronic
944636030 2:201676904-201676926 ATAAAAACATTTAAAAAGTAAGG + Intronic
945432829 2:209784826-209784848 AGAAAAGCACATAAAGCATTTGG - Intronic
945497923 2:210532597-210532619 ACAGGAAAATTTAAAGCATTTGG - Intronic
945547590 2:211175490-211175512 AAAACAACAGTTAAAACATTTGG + Intergenic
945604642 2:211913297-211913319 TTAAAAATATTAAAAGCAATAGG + Intronic
946495030 2:220187781-220187803 ATATATACAATTAAAGAATTTGG - Intergenic
946756004 2:222948218-222948240 ATAAAAAATTTTAAAGCTTATGG - Intergenic
946850584 2:223902655-223902677 ATTAAAACAGAAAAAGCATTAGG - Intronic
947228345 2:227861023-227861045 ATAAAAACTTTTAAAGCCTATGG - Intergenic
947390216 2:229631232-229631254 AAAAAAACATTTAAAGACATTGG + Intronic
948668308 2:239550212-239550234 ATAAATACATTTTCAGCTTTTGG - Intergenic
948989222 2:241543562-241543584 ATAAAAATATTTCAAACATTTGG + Intergenic
1169775419 20:9246998-9247020 ATAAAATAATATATAGCATTAGG + Intronic
1170270007 20:14516127-14516149 TTATAAACCTTTAAAGCACTTGG + Intronic
1170992950 20:21321754-21321776 ACAAAAACATTTAAAGCCTTTGG - Intronic
1173011318 20:39185355-39185377 GTGATAAAATTTAAAGCATTTGG + Intergenic
1173038627 20:39437457-39437479 AGAAAAACTTTTAAGGCATTTGG - Intergenic
1173212727 20:41049212-41049234 TTAAAAACACTTCAAGAATTAGG - Intronic
1173403615 20:42746077-42746099 ATTAACACTTTTAACGCATTTGG - Intronic
1174522956 20:51146035-51146057 ATTAAAACACTCAAAGCACTAGG + Intergenic
1174523058 20:51147647-51147669 ATAAAAACATTTAAATTAGGAGG + Intergenic
1174655286 20:52166823-52166845 ATGAAAGCACTTAATGCATTTGG - Intronic
1175040206 20:56042211-56042233 TTAAAAACATTTAAAGACATGGG - Intergenic
1175161129 20:57008766-57008788 ATAAAATCATTTCAAGAATGAGG - Intergenic
1176593394 21:8666316-8666338 ATAAACACAATAAAAGCGTTTGG - Intergenic
1176704048 21:10096827-10096849 ATAAAAACAAATAATGCTTTAGG + Intergenic
1177218803 21:18164030-18164052 ATATAAAAGTTTAATGCATTTGG - Intronic
1177349817 21:19922761-19922783 AGAAAAACATTTAAATCTGTAGG + Intergenic
1177482632 21:21711268-21711290 ATTTAAACATCTGAAGCATTGGG - Intergenic
1177521844 21:22236956-22236978 AGAATAACATTTAAATCAGTAGG + Intergenic
1177735036 21:25078545-25078567 ACAAAAACATATGAAGCATGTGG + Intergenic
1177828998 21:26115817-26115839 ATAAAAATGTTTAAAAAATTAGG - Intronic
1177994279 21:28076463-28076485 ATAAAAACTTTTGACCCATTCGG - Intergenic
1178281460 21:31286410-31286432 ATAAAAATATTTAAAGGACTGGG + Intronic
1178450076 21:32690367-32690389 ATAAAAAAATAAAAATCATTCGG - Intronic
1178505334 21:33158046-33158068 ATAAAAACACTTGTAGCATAAGG - Intergenic
1178577787 21:33810232-33810254 ATGCAAACCTTAAAAGCATTTGG + Intronic
1179080291 21:38164532-38164554 ATAAAAACATTTTATTCATTGGG + Intronic
1179241142 21:39593841-39593863 ACCAAAACATTTGAAGCATTAGG + Intronic
1180165730 21:46026654-46026676 ATAAATTCATTTAAAACTTTGGG + Intergenic
1180276241 22:10643444-10643466 ATAAACACAATAAAAGCGTTTGG - Intergenic
1180550721 22:16536457-16536479 ATAAACACAATAAAAGCATTTGG - Intergenic
1181341489 22:22183490-22183512 ATAAAAAGATTTAAAATTTTTGG + Intergenic
1181353915 22:22283504-22283526 ATAAACACAATAAAAGCGTTTGG + Intergenic
1181660400 22:24342890-24342912 AAAAAAACATTTGAAGAAATAGG + Intronic
1181816203 22:25438449-25438471 AAGAAAACATATAAAGCAGTGGG + Intergenic
1182597802 22:31435583-31435605 ACAAAAAAATTTAAAAAATTAGG + Intronic
1182705327 22:32273824-32273846 GTAATAGCATTTAAAGTATTTGG - Intergenic
1185020692 22:48373093-48373115 ATAAGTACTTTTAAAGCATTTGG - Intergenic
1185205179 22:49533740-49533762 ATATAAACATTTCAACCTTTGGG - Intronic
949582438 3:5402174-5402196 ATAAAAATAGTAAAAGCTTTGGG - Intergenic
949722399 3:7005560-7005582 ATAAGAACATTTCATGCAGTGGG + Intronic
950241934 3:11378315-11378337 ATAAAGACATTTTAAAAATTTGG - Intronic
950760920 3:15225225-15225247 ATAAAAAATGTTAAAGTATTTGG - Intronic
950769184 3:15297488-15297510 ATTAGTACATGTAAAGCATTTGG - Intronic
950961207 3:17109710-17109732 AGAAAAACATTAAAAGTGTTAGG + Intergenic
950975904 3:17244597-17244619 ATAAAAACATTTAATGCAGTGGG + Intronic
950987470 3:17390465-17390487 ATTAAAACAGACAAAGCATTGGG + Intronic
950993361 3:17465722-17465744 ATAAAACCATTTGAACTATTTGG - Intronic
951089673 3:18557586-18557608 ATAAAAACACTTAAATCCTTGGG + Intergenic
951817360 3:26769000-26769022 CTAAATACATCTAAAGCCTTTGG - Intergenic
951829778 3:26913696-26913718 ATAGAAACTTTGATAGCATTTGG + Intergenic
952190444 3:31017464-31017486 ATTAATACATGTAAACCATTTGG - Intergenic
952740210 3:36727302-36727324 TTAAAAACAAATAAAGCATTTGG + Intronic
953011087 3:39025924-39025946 ATAAAAATACTTAGTGCATTAGG - Intergenic
953763951 3:45718715-45718737 ATAAAAACATTTAATGTAAGAGG + Intronic
953933085 3:47016431-47016453 ATAAAATCAATTAAAGAACTTGG - Intronic
954189203 3:48944486-48944508 TTAAAAACATATATAACATTTGG + Intronic
954893650 3:53956560-53956582 ATAAAAACATTTTAAGAATGTGG - Intergenic
955173944 3:56594007-56594029 ACAAAAACAATTAGAGCATCAGG + Exonic
955296972 3:57744740-57744762 AAAAAAAAGTATAAAGCATTAGG + Intergenic
956024670 3:64970293-64970315 AAAAAATCATTTAAAGCTTCTGG - Intergenic
956476349 3:69624298-69624320 ATAATAACATTTAATGCAAACGG + Intergenic
956488635 3:69748167-69748189 AAAAAAATCTTCAAAGCATTTGG + Intronic
957125372 3:76152725-76152747 ATAAATACCTTTAAAGTTTTAGG + Intronic
957289201 3:78256189-78256211 TTAAAAACCTTAATAGCATTTGG - Intergenic
957379552 3:79408234-79408256 ATAAAAAAAATTAAAAAATTTGG + Intronic
957381990 3:79443448-79443470 ATAAAAACCATTATAGCTTTTGG + Intronic
957573731 3:81982950-81982972 AAAAAAAAATTTAAACGATTTGG - Intergenic
958153745 3:89726121-89726143 ATAAAATCATTTAAACAAGTAGG - Intergenic
958794954 3:98697261-98697283 CTAAACACATAGAAAGCATTGGG + Intergenic
959167008 3:102793316-102793338 ATAAAAAAATTTAAATCTCTTGG - Intergenic
959250739 3:103940686-103940708 ATAAAAACACAGAAAGCAATGGG - Intergenic
959391642 3:105782193-105782215 ATTTAAAACTTTAAAGCATTTGG - Intronic
959717630 3:109450522-109450544 ATAAAAATCTTTAAAAAATTGGG + Intergenic
959817212 3:110688381-110688403 ATAAAGATATTTAAGGCTTTAGG - Intergenic
960070392 3:113423588-113423610 GAAAAAACATTGAAAGCTTTAGG - Intronic
960159516 3:114334761-114334783 ACAAATAGATTCAAAGCATTAGG + Intergenic
960240634 3:115337932-115337954 ATAAAAATATTTAATGAAATAGG - Intergenic
960721707 3:120630729-120630751 ACAAAAACATCAAAAGCAATTGG + Intronic
960748133 3:120912629-120912651 AAAAAAAAAGTTAATGCATTGGG + Intronic
961783097 3:129332988-129333010 TTAAAAACATTTAAATGTTTGGG + Intergenic
962219159 3:133549040-133549062 ATAATAACATATATAGCTTTTGG + Intergenic
962420785 3:135226766-135226788 ATAATAACATTTAAAAAATATGG - Intronic
963010414 3:140764416-140764438 AGAACAAGTTTTAAAGCATTGGG - Intergenic
963072398 3:141315246-141315268 AGAAAAACTTTTTAAGTATTGGG - Intergenic
963624569 3:147654861-147654883 ATAAAATGAATAAAAGCATTTGG + Intergenic
963848768 3:150186273-150186295 AAAAAAACAGTTAAAAAATTGGG + Intergenic
963902378 3:150745081-150745103 ATAAATAGTTTTAAAGCCTTAGG + Intronic
963951002 3:151200799-151200821 ATAAGTACATGTAAAGTATTTGG - Intronic
964213359 3:154252555-154252577 ATTAAACCATTTTAAGCATTTGG + Intronic
964239710 3:154577148-154577170 ATAATAACATTGAAAGTAATTGG + Intergenic
964279152 3:155043751-155043773 GTAAAAATATTAAAAGAATTTGG - Intronic
964611128 3:158616471-158616493 ATAAAAACTTTTAATAAATTGGG - Intergenic
965067940 3:163876197-163876219 AGGAACACATTTAAAACATTTGG + Intergenic
965095446 3:164219177-164219199 ATAAAAAACATTAAAGCGTTAGG + Intergenic
965358266 3:167705112-167705134 ATATAAAAATTAAAAGCATATGG - Intronic
965361471 3:167745366-167745388 ATAAAAACATTTAACAAACTAGG + Intronic
965526836 3:169729412-169729434 ATAAAAACATTTAATGTATATGG - Intergenic
965947984 3:174265699-174265721 ATAAACAAATTTAAGGAATTCGG - Intronic
966025982 3:175282641-175282663 ATAAAAACTTTTCATGCATCTGG - Intronic
966208247 3:177426522-177426544 ATAAATTCTTTTAAAGCATCTGG - Intergenic
966431678 3:179837989-179838011 ATGCAAACATTTAAAACTTTTGG - Intronic
966638255 3:182159557-182159579 ATAGAAATATTTAAAGGTTTTGG - Intergenic
966745493 3:183271603-183271625 TTAAAAACATATAAAGTATTAGG - Exonic
967007301 3:185396425-185396447 ATAAAAGCATTTGAAGGAGTTGG + Intronic
967079050 3:186032266-186032288 TTAAAAACTTTTAAATCATCTGG + Intergenic
967206728 3:187130099-187130121 ACAAGAATATTCAAAGCATTTGG - Intronic
967706510 3:192657320-192657342 AGAAAAACTCTAAAAGCATTGGG - Intronic
969208862 4:5671069-5671091 ATTAATACATGTAAAGCACTTGG - Intronic
969393315 4:6905257-6905279 AGAAAAATCTTTAAAGAATTGGG - Intergenic
970032631 4:11694114-11694136 ATAAAAACATTTGAACCTTGAGG + Intergenic
970302725 4:14698426-14698448 ATACATACATATAAAGCATTTGG + Intergenic
970442058 4:16089562-16089584 GTGAAAACAGTTGAAGCATTTGG - Intergenic
970624100 4:17858422-17858444 AGAAATACATTTAAAGAAATTGG + Intronic
970772865 4:19636980-19637002 ATAAAGAGGTTTAAATCATTGGG + Intergenic
970830273 4:20330553-20330575 ATTAATAGTTTTAAAGCATTTGG + Intronic
971593783 4:28501354-28501376 ATAAAAACTTTTAAGCCAATGGG + Intergenic
971812521 4:31444953-31444975 TTAAAAACTTTGAAGGCATTAGG + Intergenic
972066813 4:34956835-34956857 ATAAAACTATTAAAAGCACTGGG + Intergenic
974362909 4:60905835-60905857 AAACAAACATTTACAGCATTTGG - Intergenic
974545924 4:63306696-63306718 ATTAAAACACTCAAAGCCTTTGG - Intergenic
974891154 4:67885647-67885669 ATTAAAATATTTAAATCACTTGG - Intergenic
974921413 4:68244927-68244949 ATAGAAAACTTTAAATCATTAGG + Intronic
975086441 4:70345849-70345871 AAGAAAACATTTTAAGCCTTGGG + Intergenic
975399571 4:73919026-73919048 ACAAAAATATTTAAAACATTAGG + Intergenic
975479053 4:74857543-74857565 TTAAGAATGTTTAAAGCATTGGG + Intergenic
975636507 4:76455370-76455392 AAATAAACATTTATATCATTTGG + Intronic
975649338 4:76576928-76576950 TTAAAAACAGTTTAAGCAATAGG + Intronic
975739358 4:77414006-77414028 ATAAAAACACTTTAAATATTTGG + Intronic
975894264 4:79068047-79068069 ATAAAAACACTCAAAACACTGGG + Intergenic
976533667 4:86186008-86186030 ATGATAATATTTAAAGCACTGGG + Intronic
976696991 4:87927307-87927329 ACTAAAACATTTTAAGCATGAGG - Intergenic
976972982 4:91130988-91131010 ATAAAAACATATAATTCATGTGG + Intronic
976975211 4:91158271-91158293 GTAAAAACATTTATATGATTAGG - Intronic
977014376 4:91674527-91674549 TTAAAACCATTTAAGGTATTAGG - Intergenic
977058233 4:92220432-92220454 ATAAAAACTTTCCAATCATTTGG + Intergenic
977114304 4:93003407-93003429 AGAAAAAGATATAAAGCAGTAGG - Intronic
977449209 4:97173478-97173500 ATTAATACATGTAAAGCATTTGG + Intergenic
977581621 4:98731050-98731072 AGAAAAACAGTTAAAGGCTTTGG - Intergenic
977684499 4:99832825-99832847 TCCAAAACATTTAAAGGATTTGG - Intronic
977684507 4:99832976-99832998 TCCAAAACATTTAAAGGATTTGG - Intronic
977737623 4:100436178-100436200 AAAAAAACATTTTAAGAAGTGGG + Intronic
978129187 4:105173758-105173780 ATTAAAACATTTATAAAATTAGG + Intronic
978340977 4:107720761-107720783 TGTAAAACATTTAAAACATTTGG - Intergenic
978555485 4:109974935-109974957 ATCAAGACATTAAAAGCATGAGG - Intronic
978970170 4:114793891-114793913 ATAAATACATTTAAAGTCTAAGG + Intergenic
979432989 4:120654560-120654582 ATTAAAATATATAAATCATTTGG - Intergenic
979590671 4:122476453-122476475 ATAAAAGCAGAAAAAGCATTTGG - Intergenic
980215230 4:129844145-129844167 ATAAAAATATTTTAAGCACAGGG + Intergenic
980376266 4:131953163-131953185 ATAAAAACAAATAATGCTTTAGG + Intergenic
980423726 4:132597572-132597594 ATAAATTTGTTTAAAGCATTTGG - Intergenic
980576590 4:134690315-134690337 AGAAAAATATTTAGGGCATTAGG - Intergenic
980588141 4:134847137-134847159 ATAAAAATATTTAAAACCATAGG - Intergenic
980695025 4:136343357-136343379 AAAAAAACATTTAAAAAAATGGG + Intergenic
980739859 4:136936044-136936066 ATAAAGACATTCCAGGCATTTGG - Intergenic
980917517 4:139047641-139047663 ACAAAGACATTAAAAGCACTAGG - Intronic
981026966 4:140086421-140086443 GTAAAACCACTTGAAGCATTTGG - Intronic
981140880 4:141267624-141267646 ATAAAAAGATTTTAAGCAGAGGG - Intergenic
981281926 4:142968424-142968446 ATAAAAAGAATTCAAGCATGAGG + Intergenic
981363010 4:143869289-143869311 ATAAAACCATGTTAAACATTTGG - Intergenic
981373738 4:143990096-143990118 ATAAAACCATGTTAAACATTTGG - Intergenic
981382839 4:144093349-144093371 ATAAAACCATGTTAAACATTTGG - Intergenic
981452418 4:144913774-144913796 GTAAGAAGAATTAAAGCATTAGG - Intergenic
981452742 4:144917852-144917874 ATTAAAACATTTTCAGCCTTTGG - Intergenic
981463308 4:145036096-145036118 CTAAAAAAAATTTAAGCATTAGG + Intronic
981979810 4:150777444-150777466 ATATAAAAATTTAAAGGTTTAGG + Intronic
982294701 4:153815158-153815180 ATAAAAACATTAAAATGAATGGG - Intergenic
982423376 4:155225042-155225064 ATAATAATATTAAAACCATTTGG - Intergenic
982589722 4:157292306-157292328 AAAATTACATTAAAAGCATTGGG + Intronic
982717348 4:158822811-158822833 TAAAATACTTTTAAAGCATTTGG + Intronic
983391585 4:167138241-167138263 ATGAAAACCTTAAAAACATTAGG + Intronic
983438261 4:167745486-167745508 ACAAAGACATTTAAAGTAGTTGG - Intergenic
983500821 4:168497476-168497498 ATAAATACATTTAATCCTTTTGG - Intronic
983804042 4:171970615-171970637 CTCAAAACATATAAAGTATTGGG - Intronic
983970069 4:173860658-173860680 AGAAAAACATTGATAACATTTGG + Intergenic
983978887 4:173969923-173969945 AGAAAAAACTTTAAAACATTTGG - Intergenic
984034978 4:174655341-174655363 TTTAAAATATTTCAAGCATTGGG - Intronic
984072411 4:175132174-175132196 AGAAAAACATAGAAAACATTTGG - Intergenic
984289409 4:177775553-177775575 ATAGAAACACTTAAAGCTCTTGG + Intronic
984374767 4:178914016-178914038 AATAAAACATTTATAGCACTTGG + Intergenic
984466878 4:180110866-180110888 TTGAAAACATTTCAAGCATCTGG + Intergenic
984641656 4:182172577-182172599 ATAAAAACATTTTGAGTATAGGG - Intronic
984675053 4:182537955-182537977 ATAAAAACAGTTAAATCACTGGG - Intronic
984717251 4:182937238-182937260 TTAGAAACAATTAAAGCAATCGG + Intergenic
984865369 4:184276040-184276062 CTGAAAACTTTTAAAGCATTAGG - Intergenic
985158785 4:187021819-187021841 ATAAAAATATTTCATTCATTTGG + Intergenic
985336235 4:188898281-188898303 ATAACAAAATTTCAAGCATAAGG + Intergenic
986453459 5:7890542-7890564 ATAAAAAAATTAAAGTCATTGGG + Intronic
986927316 5:12771642-12771664 ATAAAGACATTAGAAGTATTTGG + Intergenic
987075351 5:14377067-14377089 ACAAAAAATTTTTAAGCATTGGG - Intronic
987603005 5:20097028-20097050 ATATAAATATTTAAAATATTTGG - Intronic
987619702 5:20325086-20325108 TTACAAACCTTAAAAGCATTCGG - Intronic
987759012 5:22134659-22134681 ACAAAAATATTTAAAGCTCTGGG - Intronic
988010947 5:25484806-25484828 ATGACAACATTTAAAGCAACCGG - Intergenic
988038259 5:25855890-25855912 AGACAAACATTTTCAGCATTGGG - Intergenic
988062532 5:26191410-26191432 TTAAAAACATTTAGATCATTGGG - Intergenic
988190351 5:27922630-27922652 ATAAAAAAGTTTTTAGCATTAGG + Intergenic
988438635 5:31206896-31206918 ATAAAACCATGTTAAGCTTTTGG - Intronic
988907730 5:35807137-35807159 ATAAAAACATTTCAAGACCTAGG + Exonic
988948048 5:36226797-36226819 ATAAAAGCTTTTAAAGCACATGG - Intronic
989277732 5:39609400-39609422 ATAAAAGCATTTGAAGGTTTAGG + Intergenic
989662967 5:43819283-43819305 ATTAAATCATTTGATGCATTAGG - Intergenic
990130963 5:52582609-52582631 ATAAAAACATTTCAAGAAAATGG - Intergenic
990427767 5:55705364-55705386 ACAATAACATGTAAAACATTAGG - Intronic
990566901 5:57039206-57039228 ATAAAAACATTTATGGCCCTTGG + Intergenic
990955998 5:61339448-61339470 ACAAAAAAATATAAAGCATGTGG - Intronic
991893722 5:71368106-71368128 ACAAAAATATTTAAAGCTCTGGG - Intergenic
992020998 5:72623966-72623988 AAAAAAAAATTTAAACCCTTGGG - Intergenic
992064455 5:73092924-73092946 AAAAAAAATTTTAAAGCCTTTGG - Intergenic
992213900 5:74507080-74507102 ATGAATACATATAAAGCACTCGG + Intergenic
992512939 5:77457992-77458014 AGAAAAAAATTTAATGTATTTGG - Intronic
993001210 5:82382660-82382682 AGACAAACATATAAATCATTTGG + Intronic
993042071 5:82825615-82825637 TTAAGAACTTTTAAAGCAGTGGG - Intergenic
993238078 5:85341704-85341726 ATAGAAACATCTACAGGATTTGG + Intergenic
993331913 5:86611348-86611370 ATAAAAACCTTTAACAAATTAGG - Intergenic
993433024 5:87855235-87855257 ATGAAATCATGTAAAGCAGTTGG + Intergenic
993436152 5:87897888-87897910 ATAGAACCATTGCAAGCATTGGG + Intergenic
993462730 5:88204418-88204440 ATAAAAACATTTAAAGCATTTGG - Intronic
993614888 5:90098372-90098394 AAGACAACATTTCAAGCATTTGG - Intergenic
993636139 5:90346111-90346133 AAAAAGAGATTTAAATCATTGGG - Intergenic
993679945 5:90864229-90864251 ATATAAACTTTTAAAGCATCTGG + Intronic
993795592 5:92263024-92263046 ATAAATACATTTCAAGGATCTGG - Intergenic
993936240 5:94006811-94006833 ATTAAAAGTTTTAAAGCTTTCGG + Intronic
994130172 5:96218448-96218470 CAAAAAACATTTTAGGCATTTGG + Intergenic
994163461 5:96583089-96583111 ATAAAAACCATTAAAGGTTTGGG - Intronic
994457606 5:100032184-100032206 ATAAAAACCCTTAAAAAATTGGG + Intergenic
994516268 5:100776120-100776142 TTAAAAATATTTTAAGCTTTAGG - Intergenic
994560023 5:101356931-101356953 ATGAATACATTTAAATTATTTGG + Intergenic
994629533 5:102266809-102266831 ATAAAAACTTTTAAGAAATTAGG - Intronic
994711449 5:103269453-103269475 AAAAAAACAGTGAAAGCATATGG + Intronic
994715220 5:103313427-103313449 ATGAGATCAATTAAAGCATTAGG - Intergenic
994913899 5:105947872-105947894 ATAAAATCATTTAAAACACAAGG + Intergenic
995074262 5:107963031-107963053 AAAAAAACACTTAAAATATTTGG + Intronic
995330598 5:110941498-110941520 AGAAGAACATCTAAAGAATTTGG + Intergenic
995494567 5:112726996-112727018 ATAGACTCATTTTAAGCATTAGG - Intronic
995616083 5:113965868-113965890 ATATAAACAGTTAGAACATTTGG - Intergenic
995716898 5:115089296-115089318 ATATAAAAGTATAAAGCATTTGG + Intergenic
996179137 5:120397922-120397944 AGAACAACATTTGAAGAATTTGG + Intergenic
996259684 5:121450715-121450737 ATAAAAACCTGCAAAACATTGGG + Intergenic
996315444 5:122155466-122155488 ATAAGAACTTTCAAAGCAGTGGG + Intronic
996335182 5:122376512-122376534 AAGAAAACATTTCAAGCACTGGG - Intronic
996940322 5:128997406-128997428 ATAAAAGCATTTAGAGAAGTTGG + Intronic
997747233 5:136310009-136310031 ATAAAAAGATTAAAATCCTTAGG + Intronic
998056233 5:139080192-139080214 ATGAAAACAGTTAAATCATTAGG + Intronic
998090383 5:139363289-139363311 CTTAAAACATTAAAATCATTTGG + Intronic
998326466 5:141284861-141284883 ATATAAGCATATAAAGCATGTGG + Intergenic
999026745 5:148242133-148242155 AGAAAACCATTTAAAGGAATTGG + Intergenic
999448816 5:151663493-151663515 ATCCAAACATTTTAAACATTGGG + Exonic
999497058 5:152109290-152109312 ATTAAAAGATTTTAAGCAGTAGG + Intergenic
999585540 5:153085783-153085805 ATAAAGTCTTTTAAAGAATTTGG + Intergenic
1000413892 5:160963286-160963308 ATAAAAAGATGGAAAGAATTTGG - Intergenic
1000853615 5:166371264-166371286 TTAAAAATATTTATTGCATTTGG + Intergenic
1001729810 5:173943994-173944016 ATATAAACTTTTAAATCATAAGG - Intronic
1002555397 5:180034077-180034099 AAAAAAGCATTTAACACATTAGG - Intronic
1002849491 6:980973-980995 ATAAAAGCATTCAAAGCCTCTGG - Intergenic
1003373684 6:5553582-5553604 AAAAAAAAATTTAAATCCTTCGG - Intronic
1003462820 6:6347414-6347436 ATAAAAATATTTGCAGCACTGGG - Intergenic
1004393531 6:15228830-15228852 ACAAAAAAAATTAAAACATTAGG + Intergenic
1004580137 6:16942665-16942687 ACAGAAAAATTTAAAGCTTTAGG - Intergenic
1005150802 6:22748233-22748255 ATAAAACCATGTAAATCACTTGG + Intergenic
1005464911 6:26103546-26103568 ATAAAAATATTAAAATGATTGGG + Intergenic
1005641399 6:27799899-27799921 CTAAAAACTTTTAAAAAATTAGG + Intergenic
1006264109 6:32902695-32902717 TTACGAACATTCAAAGCATTAGG + Intergenic
1006565960 6:34957534-34957556 AAGAAAACATTGAAAGCCTTTGG + Intronic
1007059295 6:38922466-38922488 ATATTAACATTTAAATAATTAGG + Intronic
1007175723 6:39895845-39895867 AAGATAACATTTAGAGCATTGGG + Intronic
1007268599 6:40618187-40618209 GTAAACATATATAAAGCATTTGG + Intergenic
1008029852 6:46682739-46682761 ATAAAAACATTAAAAACTTAGGG + Intergenic
1008379627 6:50826430-50826452 AAAAAAATATTAGAAGCATTTGG - Intronic
1008470020 6:51874620-51874642 ATTAAGACTTTTAAAGAATTTGG - Intronic
1008690454 6:53972905-53972927 ATATAAACATTTATAGAAATAGG - Intronic
1008697971 6:54063568-54063590 ATTAAACAATTTAAAACATTTGG + Intronic
1009321057 6:62288591-62288613 ATCAAGACATTAAAAGCATATGG + Intergenic
1009328295 6:62382101-62382123 AAAAAAAGCTTTAAAACATTTGG - Intergenic
1009496030 6:64347741-64347763 ATAAACACATTTAAAATATAAGG - Intronic
1009553033 6:65124207-65124229 AAAAAAACATTGAAAGCAAAAGG + Intronic
1009718481 6:67431021-67431043 ATTTAAACATTTAAAATATTGGG - Intergenic
1010122664 6:72396324-72396346 ATTAAAAGATTTAAACAATTTGG - Intronic
1010124554 6:72416871-72416893 ATAACAACATTTTAAGGATGAGG + Intergenic
1010244538 6:73651099-73651121 CAAAAAACATTTCAATCATTTGG + Intronic
1010501484 6:76606576-76606598 ATAAAAATATTTTAAACATTAGG - Intergenic
1010545984 6:77156918-77156940 ATTAAAACATTTAACAAATTTGG - Intergenic
1010626019 6:78137096-78137118 GTAAAAACTGTTAAAGCGTTAGG - Intergenic
1010929329 6:81781601-81781623 AGAAAAAAAATTAAAACATTTGG + Intergenic
1011007677 6:82665633-82665655 ATAAAAGTTTTTAAATCATTTGG - Intergenic
1011098377 6:83693049-83693071 ACAAAAACAGTTAAAACATCAGG - Intronic
1011173229 6:84530014-84530036 AAATAATCATTTAAAGCATCTGG + Intergenic
1011208803 6:84931939-84931961 ACAAAGACATTTGAAGCATGAGG - Intergenic
1011545077 6:88474516-88474538 TAAAAAAGATTTAAAGCCTTGGG - Intergenic
1011743938 6:90391032-90391054 ATTAAAACACATAAAGCACTTGG - Intergenic
1012012235 6:93804045-93804067 TTAAAAATATATAAATCATTGGG - Intergenic
1012059128 6:94455221-94455243 GTAAAAACATTTAAAACTTTGGG + Intergenic
1012108319 6:95194220-95194242 TTTAAATCCTTTAAAGCATTTGG - Intergenic
1012935443 6:105363154-105363176 AAAAAAACTTTTCAAGAATTAGG + Intronic
1013072923 6:106745162-106745184 ATAAAGAGAGTTAAAGCACTTGG - Intergenic
1013162923 6:107563341-107563363 AGAAAAACATTTGTACCATTGGG + Intronic
1013386566 6:109637698-109637720 ATGGAAATATTTAAAGCAGTGGG - Intronic
1013463194 6:110395146-110395168 AGAAAAACATTTAAATCAGTGGG + Intronic
1013692062 6:112657447-112657469 ATAATTATTTTTAAAGCATTAGG + Intergenic
1013719641 6:113008348-113008370 AGAAAAATATTTAAAACATCAGG + Intergenic
1013786452 6:113787002-113787024 ATAAAAATATTTTAAGCAATAGG + Intergenic
1013793985 6:113864276-113864298 ATAAATACTTTTAAAAGATTAGG + Intergenic
1013850896 6:114514222-114514244 ATAAAAAGATTTTAAACATGTGG + Intergenic
1014119723 6:117710769-117710791 ATAAAATTATTTGAAGAATTTGG - Intergenic
1015085676 6:129288281-129288303 ATAAAAACATGTTTATCATTTGG - Intronic
1015259384 6:131217957-131217979 ATAAAAACATTCAAAGTAAATGG - Intronic
1015307045 6:131721114-131721136 TTAAAAAACCTTAAAGCATTAGG + Intronic
1016158674 6:140847664-140847686 ATGTATTCATTTAAAGCATTAGG - Intergenic
1016656016 6:146519254-146519276 ATAAAAACGCTTAATGCATTTGG - Intergenic
1016669721 6:146689514-146689536 ATAAAATGATTTAAAGCATTTGG - Intronic
1016970929 6:149762186-149762208 ATAAAAACCTTGAAAAAATTAGG - Intronic
1017090817 6:150757296-150757318 ATTAAAACATTTACAGCAGGTGG - Intronic
1017656195 6:156631917-156631939 ACACAAACATTTAAATTATTGGG + Intergenic
1017959828 6:159211748-159211770 ATATAACCATGTAAAGCGTTCGG - Intronic
1018023628 6:159787445-159787467 ATACCAACATTTAAAACAATGGG + Intronic
1018445725 6:163856262-163856284 ATAAAAACATTTTGGCCATTTGG + Intergenic
1020172461 7:5855825-5855847 AAAAAAAGAATTAAAGCTTTTGG - Intergenic
1020195742 7:6037388-6037410 ATGAAATCATTGAAAGCAGTGGG - Intronic
1020216499 7:6195193-6195215 ATGAAAACATTTAACTGATTAGG - Intronic
1020342013 7:7121852-7121874 AGAAACACATTGAAGGCATTGGG - Intergenic
1020510177 7:9046708-9046730 ATAAAACCATGTAATTCATTTGG + Intergenic
1020590556 7:10131285-10131307 AAAAAAATGTTTAAAGCATATGG - Intergenic
1021255351 7:18385743-18385765 ATAAAAAGATTCAGTGCATTGGG - Intronic
1021429252 7:20540914-20540936 ATGAAAACATCAAAAGCAATGGG + Intergenic
1022287781 7:28971131-28971153 GTAATAATATTTTAAGCATTAGG - Intergenic
1022379720 7:29848281-29848303 ATTCAAACATTTTAAACATTTGG + Intronic
1022622888 7:32002862-32002884 ATGAAAAAGTTTAAATCATTTGG + Intronic
1022788764 7:33665432-33665454 TTAAAAAAATATAAAGCACTTGG - Intergenic
1022874971 7:34519364-34519386 ATAAAAACCATTAAAGGTTTGGG - Intergenic
1023472539 7:40540064-40540086 ACAAAAACATTTTAAACATTTGG - Intronic
1023486537 7:40693393-40693415 ATGAATGCATGTAAAGCATTTGG - Intronic
1023636721 7:42219364-42219386 ATATCAACATATAAAGCCTTTGG - Intronic
1023774337 7:43589797-43589819 ATAAAATAATTCAAAGCAGTAGG - Intronic
1024662211 7:51508905-51508927 ATAAAAAGATAAAAAGCAGTGGG - Intergenic
1024688849 7:51777859-51777881 AAAAAAACATTTAAAGCCGTGGG - Intergenic
1024975041 7:55105786-55105808 ATTAAAATAGTTAATGCATTTGG - Intronic
1026039771 7:66858184-66858206 ATTAAAAAATGTTAAGCATTAGG - Intergenic
1026260376 7:68749660-68749682 AGAAAGACTTTGAAAGCATTAGG + Intergenic
1027371848 7:77514511-77514533 GAAAAAATATGTAAAGCATTTGG + Intergenic
1027583498 7:80026860-80026882 ATCACAACATTTAAAGCTTTTGG - Intergenic
1027743308 7:82040398-82040420 ATGATAACATTTAAAGCATGAGG + Intronic
1027796930 7:82707119-82707141 ATTAATATATTTAAAGAATTAGG - Intergenic
1027872192 7:83721167-83721189 AAAAAAAAATTTAATGAATTGGG + Intergenic
1027902775 7:84138717-84138739 AGAAGAACATCTAAAGGATTTGG - Intronic
1027969122 7:85055302-85055324 ATAAAAACATTTTAAGCTCCAGG + Intronic
1028055708 7:86239494-86239516 ATAAAAACATATACAGGACTGGG - Intergenic
1028396171 7:90370703-90370725 ATAAAAACATTAAAAGAAATAGG + Intronic
1028680172 7:93519504-93519526 ATAAATACATATAAAATATTTGG + Intronic
1028812431 7:95102947-95102969 AGATGAACATTTAAAGCAGTGGG + Intronic
1028825001 7:95261613-95261635 ATTAAAAGATTTAAAGAATTAGG - Intronic
1028903023 7:96122249-96122271 TTAAAAATATTTAAAGATTTAGG - Intronic
1029002686 7:97171644-97171666 ATAAAATGTTTTAAACCATTTGG + Intronic
1029466387 7:100727842-100727864 AAAAAAAATTTTAAAGCAGTGGG + Intergenic
1029997852 7:105026974-105026996 ATAAAAACCATTTAAGCATGAGG - Intronic
1030131700 7:106207132-106207154 ATAAAAACCTTTAAAAAAGTAGG - Intergenic
1030248713 7:107416464-107416486 ATAGAAACATTAACAACATTTGG + Intronic
1030415731 7:109240489-109240511 CTAAAAATTTTTAAAGCATGTGG + Intergenic
1030449829 7:109694055-109694077 ATAAAAAGATTTTAAATATTGGG - Intergenic
1030490691 7:110230302-110230324 ATGAAAAAATTTAATGCTTTAGG + Intergenic
1030714696 7:112793814-112793836 ATGAAAATATTTACATCATTGGG - Intergenic
1030922779 7:115412857-115412879 TTAAAAATGTATAAAGCATTTGG + Intergenic
1031031188 7:116737033-116737055 AGAAAAACATTTATAGCAGTAGG + Intronic
1031043715 7:116863842-116863864 ATAAAAACATCTAGAGCAGAGGG - Intronic
1031074739 7:117201529-117201551 AAAAAAACATAAAAAGCAGTTGG - Intronic
1031206183 7:118760708-118760730 ATAAAACCATTTAAACTATTTGG + Intergenic
1031329810 7:120450706-120450728 ATGAAAACATTTAAAGGAGTAGG + Intronic
1031449332 7:121895107-121895129 ATATACCCTTTTAAAGCATTTGG - Intronic
1031489947 7:122374211-122374233 ATAAAAGCATTCAAAATATTAGG + Intronic
1032679777 7:134169568-134169590 ATAAGAATATTTAAAACCTTAGG - Intronic
1032706828 7:134427248-134427270 ATAAAAATAATGAAAGTATTAGG - Intergenic
1032913797 7:136463846-136463868 ATACATATATTTATAGCATTTGG + Intergenic
1032987320 7:137352657-137352679 ATATAAACATTTATATCGTTAGG + Intergenic
1034049998 7:147972994-147973016 AAAAAAACATTTAAAACAGTGGG + Intronic
1034317540 7:150147154-150147176 TTAAAAACATTTAAAATATTAGG + Intergenic
1034775214 7:153820072-153820094 TTAAAAACATTTAAAATATTAGG - Intergenic
1035129973 7:156642555-156642577 ATAAAAACTCGTAAAGCATACGG - Intronic
1035441827 7:158908501-158908523 ATAAAAACATTTTATGCATTAGG - Intronic
1035516140 8:233307-233329 AGAAAACCATCTAAAGAATTTGG - Intronic
1035966182 8:4194651-4194673 ATAAAAACATTTAATAAAATGGG + Intronic
1036040837 8:5079066-5079088 TTTAAAAAAATTAAAGCATTTGG - Intergenic
1036228953 8:6983454-6983476 ATAAAAACCTTGACATCATTAGG + Intergenic
1036231404 8:7002559-7002581 ATAAAAACCTTGACATCATTAGG + Intronic
1036233862 8:7021655-7021677 ATAAAAACCTTGACATCATTAGG + Intergenic
1037108554 8:15138809-15138831 ATAAAAATGTTTAAACCATGTGG + Intronic
1037169358 8:15873275-15873297 ATAGAAAAATTTAAAGAAATAGG + Intergenic
1038005520 8:23426697-23426719 CTCAAAACACTTAAAACATTTGG - Intronic
1038825313 8:30992816-30992838 AAAAAAAGATTTAAAGCATAAGG + Intergenic
1040428511 8:47313827-47313849 ATAAACACCTTTAAAGTACTGGG + Intronic
1040636648 8:49282855-49282877 ATATAAACATATACTGCATTAGG + Intergenic
1040666235 8:49637083-49637105 ATAAAAATAACTAAAGCATTTGG - Intergenic
1040669562 8:49673029-49673051 ATGAAAACATCAAAAGCAATTGG + Intergenic
1040739978 8:50561545-50561567 ATAAAAAAGTTTAATGCACTAGG + Intronic
1040778415 8:51075430-51075452 ATAAAAATTTTTATATCATTTGG - Intergenic
1040841053 8:51785554-51785576 ATGAAAACATTTGAAATATTGGG - Intronic
1041405014 8:57488712-57488734 ATAAAAACTTTTAACAAATTAGG + Intergenic
1041603598 8:59753135-59753157 TTAAAAAAATTTAAACCATAAGG + Intergenic
1041625261 8:60018460-60018482 ATAAAGAAATTCAGAGCATTAGG + Intergenic
1041739338 8:61141338-61141360 TTAAAAAAAGTTACAGCATTTGG + Intronic
1041887947 8:62834135-62834157 ATAAAAACACTCAACGAATTAGG + Intronic
1042583876 8:70313756-70313778 GTATAAACATTTTAAGGATTAGG - Intronic
1042955669 8:74247880-74247902 ATATATACATTAAAAACATTAGG + Intronic
1043062754 8:75525968-75525990 ATAAAAATATTTACTGCATTTGG + Intronic
1043087374 8:75850978-75851000 ATGAAAACATTTTAAGTATATGG + Intergenic
1043224519 8:77707731-77707753 GAAAAAACATTTAAAGAAATAGG - Intergenic
1043303491 8:78764156-78764178 ATAAAAAATTTTAACACATTAGG + Intronic
1043792880 8:84495424-84495446 ATAAAAAATTTTAAATCAATTGG - Intronic
1043792944 8:84496545-84496567 ATATATACACTTAAATCATTTGG + Intronic
1043924042 8:86016592-86016614 ATAACACCATTTACAGCAGTAGG - Intronic
1045069762 8:98490031-98490053 ATAAAAACAGTTTAAGAAATGGG - Intronic
1045147922 8:99368649-99368671 TTAAAATTATTTAAGGCATTTGG - Intronic
1045278495 8:100728199-100728221 AAAAAAAGATATAAAGTATTTGG + Intergenic
1045350060 8:101330286-101330308 ACAAAAACATTTAAATTATGAGG - Intergenic
1045724234 8:105152775-105152797 ATAAAAACATTGAAAGGAGCAGG + Intronic
1045752661 8:105504016-105504038 ATACAAACATTTAAAAAATAAGG - Intronic
1045958513 8:107938573-107938595 ATAGAAACATGTAAAGTATTTGG + Intronic
1046257419 8:111719638-111719660 GTAATAAAATTTAAGGCATTTGG + Intergenic
1046325936 8:112646611-112646633 ATAAACACATTTAAACATTTAGG + Intronic
1046589244 8:116186237-116186259 TTAAAAAAAAATAAAGCATTTGG + Intergenic
1046634342 8:116656807-116656829 ATATAAACATTTTAAGAATTTGG - Intronic
1046809147 8:118514043-118514065 CATAAAACTTTTAAAGCATTGGG + Intronic
1047042428 8:121011264-121011286 ATAAAAAGATTATAAGCATTTGG - Intergenic
1047707829 8:127518671-127518693 ATAAAAAAATTGAAAACAGTGGG + Intergenic
1047938989 8:129809055-129809077 ATAAAAATATATAAACCACTAGG - Intergenic
1047979269 8:130162948-130162970 ATACATAGTTTTAAAGCATTTGG - Intronic
1048058480 8:130892556-130892578 ATGAAAACAGTTTAATCATTTGG + Intronic
1048364150 8:133723651-133723673 ATATATACATTTATAGCATATGG - Intergenic
1048628216 8:136210576-136210598 ATAAAAACTATTAAAGTATGAGG + Intergenic
1048699855 8:137076724-137076746 ATAAATAAATTTAAAACAATAGG + Intergenic
1048772554 8:137910902-137910924 ATAAAAATATCCAAAGAATTTGG + Intergenic
1049996655 9:1041580-1041602 AAGAAAGCATTTAAAGCATAAGG - Intergenic
1050083840 9:1943165-1943187 AATTAAATATTTAAAGCATTTGG - Intergenic
1050548837 9:6731928-6731950 ATGTAAACATTTAAAACCTTTGG + Intronic
1050585433 9:7106219-7106241 GAAAGAACATTTAAAGCAATAGG - Intergenic
1050762151 9:9085771-9085793 TATAAAACATTTAAAACATTTGG - Intronic
1050933612 9:11364247-11364269 ATAGACACATAGAAAGCATTTGG + Intergenic
1051111389 9:13641292-13641314 ATAAAAACATTCAACAAATTAGG + Intergenic
1051718676 9:20011996-20012018 ATAAAAACTTTTAACAGATTAGG + Intergenic
1051799930 9:20921069-20921091 AAAAGAACATTTAAAGCTTCAGG + Intronic
1051821182 9:21170823-21170845 ATAAAAACATTTAACAAACTTGG + Intergenic
1052420482 9:28237041-28237063 ATAAAAAAATTTAAAGTCATAGG + Intronic
1052587274 9:30445083-30445105 ATAAAAACATATAAATCAGATGG + Intergenic
1053641314 9:40083855-40083877 ATAAAAACAAATAATGCTTTAGG + Intergenic
1053692830 9:40603878-40603900 ATAAACACAATAAAAGCGTTTGG - Intergenic
1053764825 9:41381627-41381649 ATAAAAACAAATAATGCTTTAGG - Intergenic
1054272003 9:63036216-63036238 ATAAACACAATAAAAGCGTTTGG + Intergenic
1054304070 9:63403105-63403127 ATAAACACAATAAAAGCGTTTGG - Intergenic
1054322055 9:63680143-63680165 ATAAAAACAAATAATGCTTTAGG + Intergenic
1054402817 9:64727118-64727140 ATAAACACAATAAAAGCGTTTGG - Intergenic
1054436440 9:65212608-65212630 ATAAACACAATAAAAGCGTTTGG - Intergenic
1054493958 9:65809386-65809408 ATAAACACAATAAAAGCGTTTGG + Intergenic
1054543436 9:66292777-66292799 ATAAAAACAAATAATGCTTTAGG - Intergenic
1054746874 9:68862936-68862958 ATAAAAAGATATAAAGCATGTGG + Intronic
1054845785 9:69796224-69796246 ATAAAAACATTTTAAAAATCAGG - Intergenic
1054977041 9:71159791-71159813 ATAAAAAATTTTAAATCATGTGG + Intronic
1055384189 9:75743443-75743465 ACAAAAACATTTAAAGCTGCTGG + Intergenic
1055385258 9:75754794-75754816 ATTAAAAAGTATAAAGCATTAGG - Intergenic
1055446273 9:76385952-76385974 AGAAAAACATCTAAAGCTGTTGG - Exonic
1056785302 9:89588426-89588448 TTAAAAATATTTTAAGTATTTGG - Intergenic
1057006213 9:91562701-91562723 CTATTTACATTTAAAGCATTCGG + Intergenic
1057089866 9:92247495-92247517 ATAAAAACAAGTATGGCATTCGG - Exonic
1057776336 9:98013331-98013353 AAAAACACATTTAAAACATGGGG - Intronic
1058208684 9:102139769-102139791 CTACAACCATTTAGAGCATTCGG - Intergenic
1058267211 9:102917423-102917445 ATAGTAACATTTCAAACATTGGG - Intergenic
1058346529 9:103970162-103970184 ACAAACACTTTTAAAGCATCAGG - Intergenic
1059220347 9:112610315-112610337 AAAAAAAGATTTAAAGCAGAAGG + Intronic
1059605821 9:115834054-115834076 ATAATAATTTTTAGAGCATTGGG - Intergenic
1059974980 9:119706407-119706429 ATAGAATAATTTAAAGTATTGGG - Intergenic
1060047974 9:120355757-120355779 ATAAATACATTTTAAGTATTAGG - Intergenic
1060452960 9:123760836-123760858 ATTAAAATATTTAAAGCAACAGG + Intronic
1061110878 9:128569989-128570011 CTAATAACATTTAACCCATTTGG + Intronic
1202789085 9_KI270719v1_random:66920-66942 ATAAAAACAAATAATGCTTTAGG + Intergenic
1185756994 X:2660033-2660055 ATATAAAAATTTAAAAAATTAGG - Intergenic
1185829964 X:3291677-3291699 ATATAAAAACTTAAAGCATTTGG - Intergenic
1186172716 X:6894270-6894292 AAAAAAAAATTTAGAGCCTTAGG + Intergenic
1186710442 X:12189677-12189699 ATAAATGCATGAAAAGCATTTGG + Intronic
1186833367 X:13413128-13413150 CTAAAAACATTTTAATTATTTGG - Intergenic
1187206539 X:17187082-17187104 ATAAAAAAAATTAAAACAATGGG + Intergenic
1187608960 X:20919501-20919523 ATAACCACTTTAAAAGCATTTGG - Intergenic
1188032614 X:25281602-25281624 ATTAAAACAATTAACGCCTTTGG - Intergenic
1188137785 X:26510956-26510978 TTAAAAATATTTAAATGATTAGG - Intergenic
1188161634 X:26812200-26812222 ACAAAAACTTTAAAAGCAGTGGG - Intergenic
1188202443 X:27308150-27308172 TTAAAAACATTTAAAGTATCTGG + Intergenic
1188203834 X:27326800-27326822 ATAAAAACATTCAGGACATTGGG + Intergenic
1188253086 X:27923860-27923882 ATAAAAACATTTAAAGGGAAAGG - Intergenic
1188266148 X:28077727-28077749 ATATAAATATATAAAGCAATAGG + Intergenic
1188372265 X:29383557-29383579 ATAAAAAAATACAAATCATTAGG + Intronic
1188424093 X:30026155-30026177 ATAAAAAAAGTGAAAGCATTAGG + Intergenic
1188587125 X:31791264-31791286 ATAAAAATATTTAGACAATTTGG - Intronic
1188720200 X:33513529-33513551 ATAGACCTATTTAAAGCATTTGG - Intergenic
1188947867 X:36330142-36330164 ATAATAAAATTGAAAGCATAAGG - Intronic
1188956302 X:36438113-36438135 ATAAAAACATTAAAAAAATACGG + Intergenic
1189128396 X:38472763-38472785 ATAAAAAAATTTAAATCATATGG + Intronic
1189447011 X:41089340-41089362 AAAAAAGCATTTAGAGCTTTTGG + Intronic
1190146922 X:47901542-47901564 ATAAATACATAAAAAGCATTTGG - Intronic
1190299110 X:49045881-49045903 AAAAAAACTTTTAAAAAATTAGG + Intergenic
1190396031 X:49985049-49985071 AAAAAACTATTTAAATCATTAGG - Intronic
1191821722 X:65317369-65317391 ATAAAAAAATTTAAAAGAGTAGG - Intergenic
1191967231 X:66772562-66772584 ATAAAAACCTTCAAAGAATTGGG - Intergenic
1192104438 X:68300321-68300343 ATAAAACAAGTTCAAGCATTTGG + Intronic
1192493690 X:71598705-71598727 CTAGAAACTTTTTAAGCATTAGG + Intronic
1192882267 X:75298290-75298312 ATATAAAGTTTTAAAGTATTAGG - Intronic
1192891134 X:75391941-75391963 ATAAAAAAATTAAAAGCATGAGG + Intronic
1192962707 X:76147127-76147149 ATATAAAGATGAAAAGCATTTGG + Intergenic
1193159795 X:78215524-78215546 GTAAAAAGTGTTAAAGCATTAGG + Intergenic
1193453167 X:81696128-81696150 ATTAATATATTTAAAGAATTAGG + Intergenic
1193457840 X:81753538-81753560 ATAAAAATATTCAAAACACTAGG - Intergenic
1194044629 X:88986860-88986882 AGAAAAACATTCTTAGCATTAGG - Intergenic
1194109743 X:89818621-89818643 ATGGAAACATTTAAAACTTTTGG - Intergenic
1194196516 X:90900929-90900951 ATAAAAACATTAAAAGAAAACGG - Intergenic
1194304551 X:92226822-92226844 ATCAAAAAATTGTAAGCATTGGG - Intronic
1194562648 X:95441711-95441733 ATAAAAATCTTAAAAGCAATGGG + Intergenic
1194770362 X:97896080-97896102 TCAAAAATATTTAAAGCATGGGG + Intergenic
1195196969 X:102507574-102507596 ATAAAAACATTAAACACACTAGG + Intergenic
1195282073 X:103345970-103345992 ATAAAAGCATTTAAAATAATCGG - Intergenic
1195397872 X:104430457-104430479 ATAAAAAGATTTAAAGCTCAGGG - Intergenic
1195422401 X:104690220-104690242 AAATAAACATTTATTGCATTAGG - Intronic
1195423393 X:104700236-104700258 ACAAAAACAGTTAAAGAATTGGG + Intronic
1195868267 X:109457186-109457208 ATAAAAACTTTAAAAGCCTCAGG - Intronic
1196330011 X:114460836-114460858 ATAAAAAGATTTGAACTATTTGG + Intergenic
1196423813 X:115549610-115549632 AGAAAAACACTCAAAGCATACGG - Intergenic
1196568278 X:117234356-117234378 ATAAATACACTTACAGTATTTGG - Intergenic
1197303414 X:124809594-124809616 ATAAAAGCAGAAAAAGCATTTGG + Intronic
1197568241 X:128115336-128115358 ATAAAAATTTAAAAAGCATTAGG + Intergenic
1197878615 X:131139648-131139670 GAAAAAACATTTAAAGTATTTGG - Intergenic
1198525910 X:137500525-137500547 AAAAAAACATCTATGGCATTGGG - Intergenic
1198629723 X:138622410-138622432 ATGAAAACATTCAAAACATTAGG + Intergenic
1198739345 X:139824399-139824421 ATAAAAAAACAAAAAGCATTAGG + Intronic
1198777234 X:140193002-140193024 ATGAATAACTTTAAAGCATTTGG - Intergenic
1198854292 X:141000324-141000346 AAAAAAACATTTTTAGCATGAGG - Intergenic
1198877722 X:141244806-141244828 AAAAAAACATTTTTAGCATGAGG + Intergenic
1198908383 X:141587392-141587414 AAAAAAACATTTTTAGCATGAGG - Intronic
1198974594 X:142322016-142322038 ATAACAGCATTTAAGGCACTTGG + Intergenic
1199083200 X:143599665-143599687 AGAAACACATTTAAACCATAGGG - Intergenic
1199183416 X:144886103-144886125 AAAAAAAAACTTAAAGTATTTGG + Intergenic
1199358971 X:146895085-146895107 ATGAAGAGATTTAAATCATTTGG - Intergenic
1199448398 X:147953211-147953233 ATATAAACAATTAAAGCCTCAGG - Intergenic
1199642599 X:149878246-149878268 AAAAAAACACTTAAAGGAATGGG + Intergenic
1199751211 X:150820335-150820357 ATAAAAACACTCAATGAATTAGG + Intronic
1200462410 Y:3473359-3473381 ATGGAAACATTTAAAACTTTTGG - Intergenic
1200542362 Y:4475129-4475151 ATAAAAACATTAAAAGAAAACGG - Intergenic
1201064192 Y:10075735-10075757 AAAGAAACATTTAAAGCTGTGGG - Intergenic
1201313497 Y:12620507-12620529 ATAAAAACATCAATAGCTTTTGG - Intergenic
1201514961 Y:14809934-14809956 GAAAAACCATTCAAAGCATTAGG + Intronic
1202174913 Y:22089002-22089024 TGAAACACATTTAAAGCAGTGGG + Intronic
1202216449 Y:22497380-22497402 TGAAACACATTTAAAGCAGTGGG - Intronic
1202326738 Y:23698689-23698711 TGAAACACATTTAAAGCAGTCGG + Intergenic
1202544031 Y:25971364-25971386 TGAAACACATTTAAAGCAGTCGG - Intergenic