ID: 993462737

View in Genome Browser
Species Human (GRCh38)
Location 5:88204465-88204487
Sequence CTGGGTAAACCATCGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993462730_993462737 24 Left 993462730 5:88204418-88204440 CCAAATGCTTTAAATGTTTTTAT 0: 1
1: 0
2: 5
3: 108
4: 907
Right 993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG 0: 1
1: 0
2: 0
3: 2
4: 63
993462729_993462737 27 Left 993462729 5:88204415-88204437 CCACCAAATGCTTTAAATGTTTT 0: 1
1: 0
2: 3
3: 65
4: 529
Right 993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG 0: 1
1: 0
2: 0
3: 2
4: 63
993462728_993462737 30 Left 993462728 5:88204412-88204434 CCACCACCAAATGCTTTAAATGT 0: 1
1: 0
2: 2
3: 110
4: 2560
Right 993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG 0: 1
1: 0
2: 0
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993462737 Original CRISPR CTGGGTAAACCATCGGATGT GGG Intronic
904672932 1:32179747-32179769 GTGGGGAAGCCATCGGACGTCGG + Intronic
913497829 1:119444673-119444695 CTGAGTAAACAATGGGTTGTGGG - Intergenic
920319575 1:205108633-205108655 CTGGGTAAAGTATCGGTTTTGGG - Intronic
1065452364 10:25872381-25872403 CTGTTTAAGCCATCAGATGTAGG + Intergenic
1065709532 10:28502131-28502153 ATGGGTAAACCCTCAGATATGGG - Intergenic
1069595263 10:69666084-69666106 CTGGGGGATCCAGCGGATGTGGG + Intergenic
1069598114 10:69685990-69686012 TTGGGTAGGCCATCGGGTGTGGG + Intronic
1071547515 10:86539639-86539661 CTGGGTGAGCCTTCTGATGTGGG + Intergenic
1085373795 11:76039241-76039263 CTTGGTAAAGCATCAAATGTTGG + Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1091805427 12:3352609-3352631 CTTGGTAAAGCATTGCATGTTGG - Intergenic
1100404370 12:94260603-94260625 CTGGGTGAACCATTGGCTGCAGG - Intronic
1103952266 12:124557776-124557798 CTGGGTAAACCAGGGGAGGAAGG - Intronic
1105471767 13:20701551-20701573 CTGAGTAAACCAGGGGATGAGGG + Intergenic
1113562128 13:111289971-111289993 CTGGGTAACCCATCAGAAGGTGG + Intronic
1114640743 14:24218486-24218508 CTAGGTAAAACATCCTATGTTGG + Intronic
1117490292 14:56240358-56240380 CTGGGTAAATGATTGGATGTGGG + Intronic
1121740796 14:96251056-96251078 CTGAGAAAACCATCGCAGGTGGG - Intronic
1124931189 15:34121299-34121321 CTGGGGAAACTTTCGGATATTGG - Intergenic
1147320498 17:39642995-39643017 CTGGGGAAGCCATTGGAGGTTGG + Intronic
1148378064 17:47168149-47168171 CTGATTAAACCATTGGCTGTTGG + Intronic
1151270991 17:72995906-72995928 CTTGGTAACCAATTGGATGTGGG - Intronic
1156588625 18:38460780-38460802 CTGGGTCAAGCGTCGCATGTTGG + Intergenic
1156732730 18:40214587-40214609 CTGAGTAAACCTTTTGATGTTGG + Intergenic
1157430159 18:47618061-47618083 CTGGGTTCACTATCGGATGAGGG - Intergenic
1165476019 19:36031567-36031589 CTGGGTAAAGGATCTGAGGTAGG - Intronic
926652986 2:15366789-15366811 CTGGGTAAGGCATCAGATGAAGG + Intronic
931229407 2:60361501-60361523 CTGGGTGAACCCTGGGCTGTAGG - Intergenic
938531841 2:132195560-132195582 ATGGGTAAATCATCTGAGGTCGG + Intronic
942061754 2:172234300-172234322 CTGGGTGAAACAAGGGATGTAGG + Intergenic
943592280 2:189813220-189813242 CTTTGGAAACCATTGGATGTTGG + Intronic
946731327 2:222712304-222712326 CTGGATAACCCAGCGGATGTTGG - Intergenic
947357388 2:229311098-229311120 CTGGGTAAAGCATAGTATGGAGG + Intergenic
1171212583 20:23328130-23328152 CTGGGGAGACCTTCGGATGGTGG - Intergenic
1173688481 20:44940644-44940666 CTGGGGAAACCCTCTGATTTTGG - Intronic
1176764620 21:13003878-13003900 ATGGGTAAATCATCTGAGGTCGG - Intergenic
1180511814 22:16098684-16098706 ATGGGTAAATCATCTGAGGTCGG - Intergenic
1180781234 22:18521002-18521024 CCAGGTAAACCCTCGGACGTGGG + Intergenic
1181238119 22:21460344-21460366 CCAGGTAAACCCTCGGACGTGGG + Intergenic
1182739077 22:32553825-32553847 CTGGATAAACTCTGGGATGTGGG - Intronic
950131300 3:10548570-10548592 CTGGGAAAACCATGAGCTGTGGG + Intronic
959228434 3:103616462-103616484 CTGGATAACTCATTGGATGTTGG + Intergenic
960458175 3:117899556-117899578 CTGGGAAAGCCATAGGATGGAGG - Intergenic
961124914 3:124408693-124408715 GTGGGTAGACCATAGGAAGTGGG + Intronic
974362350 4:60898437-60898459 CTGGGTAAAATATCCGATATTGG - Intergenic
980520846 4:133932014-133932036 CAGGGTAAACCAGGGGCTGTGGG - Intergenic
986488533 5:8265695-8265717 GCGGGTGAACCATCTGATGTCGG - Intergenic
987140971 5:14945888-14945910 GTGGGTAAAGCATGGGAGGTGGG - Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
994914328 5:105953936-105953958 TTGGGTAAAATATAGGATGTCGG + Intergenic
995108250 5:108399323-108399345 CTGGGGAAAGCAGCGGCTGTGGG + Intergenic
997150552 5:131489915-131489937 CTTTGTAAACCATCTGGTGTGGG - Intronic
997762707 5:136464719-136464741 CTGGGGAAACCATAGCATTTGGG - Intergenic
998048728 5:139012460-139012482 ATGGGTAAAAGATAGGATGTCGG - Intronic
1000133595 5:158322956-158322978 TTGGCTAAACCATCGGAGGATGG + Intergenic
1001335200 5:170790986-170791008 CTGGGAAAACCAGGGGATATTGG - Intronic
1013920385 6:115396242-115396264 CTGGTTATACCATCAGGTGTGGG - Intergenic
1014354792 6:120393456-120393478 GTGGGTAAATCACCTGATGTCGG + Intergenic
1041971360 8:63746749-63746771 CTGGGACAACCAACGCATGTTGG - Intergenic
1054420360 9:64922841-64922863 ATGGGTAAATCATCTGAGGTCGG + Intergenic
1054953170 9:70876780-70876802 CTGGGTAAAGAATGGGTTGTGGG - Intronic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1188441521 X:30218553-30218575 CTGGGTAAACCAAGAAATGTGGG - Intronic
1195700878 X:107704718-107704740 CTGGGTAATGGATTGGATGTAGG + Intergenic
1197679524 X:129367327-129367349 CAGGGTAGACCATCGGAGGAAGG + Intergenic
1198470899 X:136946019-136946041 TTGGGTAAACTACAGGATGTAGG - Intergenic