ID: 993462888

View in Genome Browser
Species Human (GRCh38)
Location 5:88207330-88207352
Sequence CCATATACTAAGTTGTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993462884_993462888 20 Left 993462884 5:88207287-88207309 CCAAGTGGAGTTTAAAACACTTT 0: 1
1: 0
2: 2
3: 15
4: 299
Right 993462888 5:88207330-88207352 CCATATACTAAGTTGTAGCTAGG 0: 1
1: 0
2: 0
3: 1
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993462888 Original CRISPR CCATATACTAAGTTGTAGCT AGG Intronic
907691409 1:56670585-56670607 CCATGTACTCAGTTGTAATTTGG + Intronic
908095326 1:60731484-60731506 CCATAAATCAAGGTGTAGCTGGG - Intergenic
911060480 1:93743725-93743747 CAGTGTACTTAGTTGTAGCTGGG - Intronic
918750036 1:188260326-188260348 CCACATCCTCAGTTGTAGTTGGG - Intergenic
922915865 1:229257215-229257237 TCAGGTACTAAGTGGTAGCTGGG + Intergenic
1068791727 10:61037165-61037187 CCAGCCACTAAGTTGTAACTGGG - Intergenic
1073828072 10:107348844-107348866 CCATACACTAAGATGGAGCAGGG - Intergenic
1078431490 11:11291904-11291926 CCATACAATATGATGTAGCTGGG + Intronic
1079898797 11:26155000-26155022 CCAAATAATAATTTGTAGATTGG - Intergenic
1079933639 11:26593365-26593387 CCAGACACTAAGTTGTGACTGGG - Intronic
1081070660 11:38605417-38605439 CCAGACACTAAGTTGTGACTGGG + Intergenic
1082734590 11:56842153-56842175 CCATATGCTGATTTGAAGCTTGG - Intergenic
1082749250 11:56999680-56999702 CCAACCACTTAGTTGTAGCTGGG - Intergenic
1091074830 11:132605655-132605677 CACTAGACTAAGTTATAGCTGGG - Intronic
1093722262 12:22458143-22458165 CCACATACTAAATAGTACCTTGG + Intronic
1095505664 12:42895500-42895522 CCATATCCAAAATTGTTGCTTGG + Intergenic
1099576707 12:84392242-84392264 CCACCTCCTAAGTTGTAACTTGG - Intergenic
1099659073 12:85532404-85532426 CCTTCTAATAAGTGGTAGCTGGG - Intergenic
1099975582 12:89542596-89542618 CCATTTACCAAGGTGTAGTTAGG + Intergenic
1107538408 13:41359998-41360020 CTATTTACTATGTGGTAGCTGGG - Intronic
1107758595 13:43652064-43652086 TTATATACTAATTTGCAGCTGGG - Intronic
1110416553 13:75259727-75259749 CCATACAATAAATGGTAGCTAGG + Intergenic
1115007163 14:28499348-28499370 CCACATGCCAAGTTGTACCTTGG + Intergenic
1116316376 14:43399860-43399882 CCATATATTAATTTTTAGTTAGG - Intergenic
1121627500 14:95397047-95397069 ACATATATTAAAATGTAGCTTGG + Intergenic
1133683240 16:8140808-8140830 CCATAAACTATGTTGTACATAGG - Intergenic
1138038758 16:53637527-53637549 CCATCTTCTTAGTTGTAGTTAGG - Intronic
1140594033 16:76387522-76387544 TCATGTACTAAGTAATAGCTTGG + Intronic
1140900746 16:79365037-79365059 CCATCAACTAAGTTCTAACTAGG - Intergenic
1144119204 17:12133788-12133810 CCATATACAACTCTGTAGCTTGG + Intronic
1148495319 17:48050037-48050059 CAATATCCTAAAATGTAGCTTGG - Intronic
1149274001 17:55014428-55014450 CCAGCCACTAAGTTGTAACTAGG - Intronic
1153095666 18:1399371-1399393 CCATATAGTAGCTTGTATCTTGG - Intergenic
1155535566 18:26812869-26812891 ACATATGCTAAGTTATAGCAGGG + Intergenic
1159968389 18:74619511-74619533 ACATATACTAACTTTTATCTTGG + Intronic
1165694872 19:37893312-37893334 CCAGCTAGTCAGTTGTAGCTGGG + Exonic
1166165883 19:40988048-40988070 CCAGCCACTAAGTTGTAACTGGG - Intergenic
925035932 2:685848-685870 CCATGTCCCAAGTTGTACCTTGG - Intergenic
930538078 2:52668634-52668656 ACATATACTAAGTGCTAACTTGG + Intergenic
932633440 2:73367127-73367149 CTATATACTCAGTTGTTTCTGGG - Intergenic
940478599 2:154198724-154198746 CCATATTCTAATTTGTTACTGGG - Intronic
947276302 2:228396091-228396113 CCATGTCCTGAGTTGTACCTTGG + Intergenic
1169465264 20:5832357-5832379 CCAAATACAAAGGTGTAACTTGG + Intronic
1172735087 20:37120710-37120732 CCGTATACTATCCTGTAGCTGGG - Intronic
1179540410 21:42079839-42079861 CCTTATACTAAAGTGCAGCTTGG - Intronic
1182943066 22:34296758-34296780 ACATATACTTAGTTGCTGCTAGG - Intergenic
952532713 3:34278876-34278898 GCATATACTAACTAGTAGGTAGG - Intergenic
953764034 3:45720157-45720179 CCATTAAATAAATTGTAGCTTGG + Intronic
954096343 3:48331735-48331757 CCAGACACTAAGTTGTGACTAGG - Intergenic
956420022 3:69078187-69078209 CAATATCCTAAGTTGAACCTTGG - Intronic
963515013 3:146298694-146298716 CCAAATCCTAAATTGTAGTTTGG - Intergenic
965753003 3:171996870-171996892 CCATTTACTAAATTTTTGCTCGG - Intergenic
972833884 4:42844992-42845014 CCAGAAACTAAATTTTAGCTTGG + Intergenic
973580791 4:52342182-52342204 CAATGAACTAAGTTGTACCTTGG + Intergenic
975393594 4:73849042-73849064 CCATGTACTATGTTGAAACTAGG - Intronic
977459986 4:97312907-97312929 CTATATACCAAGTTGAAACTAGG + Intronic
981195839 4:141919382-141919404 CCATAAACAAAGTGATAGCTAGG + Intergenic
982032782 4:151317210-151317232 CCATGTACTAAGTTAGATCTTGG - Intronic
982580294 4:157169100-157169122 ACATTTACTAAATTATAGCTGGG - Intronic
985086902 4:186323197-186323219 CTATCTACTAATTTGTAGCTTGG + Intergenic
988162852 5:27543874-27543896 CCATAGACTGAGCTGTACCTTGG - Intergenic
993462888 5:88207330-88207352 CCATATACTAAGTTGTAGCTAGG + Intronic
998501969 5:142640934-142640956 CCATATACTTAGTAGATGCTCGG + Intronic
998781509 5:145662051-145662073 CGAGATATTAAATTGTAGCTGGG - Intronic
1003320478 6:5046627-5046649 CCATATGCTTAGTTTGAGCTTGG + Intergenic
1005237935 6:23787806-23787828 TCATATACTAATTTGTACCAGGG - Intergenic
1005921706 6:30407517-30407539 CCATAGACCAAGCTGTACCTTGG - Intergenic
1008889365 6:56468741-56468763 CCAGATAATGAATTGTAGCTTGG - Intronic
1015045197 6:128768286-128768308 CCATAGCCTAAGCTGTACCTTGG + Intergenic
1023471173 7:40521921-40521943 CCAACTACTAAGTTGTTTCTCGG + Intronic
1027528798 7:79304312-79304334 TCATATACAAAGTGGAAGCTGGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1039499712 8:38006809-38006831 CCATATATTAATGTGTGGCTGGG + Intergenic
1044469551 8:92550668-92550690 CCATTTACTAAGATAAAGCTGGG - Intergenic
1046628834 8:116603507-116603529 CCAGACACTAAGTTGAAACTAGG - Intergenic
1046884913 8:119355609-119355631 CCATATTCTGATTTATAGCTTGG - Intergenic
1047490989 8:125374493-125374515 TTATATACTAATTTGTGGCTAGG - Intergenic
1189414501 X:40802517-40802539 CCAACCACTTAGTTGTAGCTGGG - Intergenic
1193940066 X:87671760-87671782 CTTTATAGTAAGTTGTAGTTGGG - Intergenic
1197434646 X:126411016-126411038 CAATATACAAAGTTGTAAATTGG + Intergenic
1197639767 X:128954782-128954804 CCATAGCCTGAGTTGTACCTTGG + Intergenic
1199263129 X:145798670-145798692 CCCTATACTAAATTGTTGTTTGG - Intergenic
1199361182 X:146920822-146920844 GCATTAACTAAATTGTAGCTAGG - Intergenic
1201504522 Y:14682880-14682902 CCACAGACTAACTAGTAGCTGGG - Intronic