ID: 993466753

View in Genome Browser
Species Human (GRCh38)
Location 5:88257007-88257029
Sequence GGCTAAAGCCTGTAATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 828
Summary {0: 1, 1: 0, 2: 25, 3: 201, 4: 601}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993466749_993466753 -2 Left 993466749 5:88256986-88257008 CCTTTTAAGACCAGGTGCAGTGG 0: 1
1: 2
2: 25
3: 150
4: 665
Right 993466753 5:88257007-88257029 GGCTAAAGCCTGTAATCTCAGGG 0: 1
1: 0
2: 25
3: 201
4: 601

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993466753 Original CRISPR GGCTAAAGCCTGTAATCTCA GGG Intronic
900278827 1:1852150-1852172 GGCTCACGCCTGTAATACCAGGG + Intronic
901078710 1:6571561-6571583 GGCTCATGCCTGTAATCCCTTGG + Intronic
901351980 1:8605474-8605496 GGCTCACCCCTGTAATCCCAGGG + Intronic
903269572 1:22178843-22178865 GGCTAAATCCTCACATCTCAAGG + Intergenic
903747694 1:25599364-25599386 GGCTCATGTCTGTAATCCCAGGG + Intergenic
903893014 1:26582694-26582716 GGCTCAGACCTGTAATCGCAAGG - Intergenic
904086102 1:27909449-27909471 GGGTAACGCCTGTAATCCCAAGG + Intronic
904096507 1:27982410-27982432 GGCTCACGCCTGTCATCCCAGGG - Intronic
904685915 1:32260400-32260422 GGCTCACGCCTGTAATCCTAGGG - Intronic
904802584 1:33104951-33104973 GGCTCATGTCTGTAATCTCAAGG - Intronic
904843327 1:33388582-33388604 GGCTCATGCCTGTAATCTTTGGG - Intronic
904900014 1:33849660-33849682 GGCTCACGCCTGTATTCCCAGGG + Intronic
905428386 1:37902461-37902483 GGCTCATGCCTGTAATCCCAAGG + Intronic
905439170 1:37982826-37982848 GGCTCATGCCTGTAATCCCAAGG + Intronic
905716425 1:40154696-40154718 GGCTCACGCTTGTAATCCCAGGG + Intergenic
906365750 1:45208092-45208114 GGCGCATGCCTGTAATCCCAAGG + Intronic
906399328 1:45493379-45493401 GGCTCAGACCTGTAATCCCAAGG + Intergenic
907220152 1:52900891-52900913 GGCTCACGCCTGTAATCACAGGG + Intronic
907253963 1:53164098-53164120 GGCTCACGCCTGTAATCTTTGGG + Intergenic
907376499 1:54047692-54047714 GGCTCACACCTGTAATCCCAGGG + Intronic
908187619 1:61667816-61667838 GGCTTACACCTGTAATCCCAGGG + Intergenic
908197008 1:61755031-61755053 GGCTCACGCCTGTAATCCCTGGG + Intronic
909829099 1:80162819-80162841 GACAAAAGCATGTAATCTAATGG - Intergenic
909951919 1:81730460-81730482 GGCTTATGCCTGTAATCTCTAGG + Intronic
910751168 1:90632843-90632865 GGCTCACGCCTGCAATCCCAGGG + Intergenic
910900908 1:92119852-92119874 GGCTCACGCCTGTAATCCCTCGG - Intronic
911112904 1:94210769-94210791 GGCTCATGCCTGTAATCCCGGGG + Intronic
912039821 1:105375819-105375841 GGCTCACACCTGTAATCCCAAGG + Intergenic
912354701 1:109045166-109045188 GGCTTATGCCTGTAATCCCCAGG - Intergenic
912375306 1:109204801-109204823 GGCTCACACCTGTAATCCCAAGG + Intronic
912678030 1:111704060-111704082 GGTTCATGCCTGTAATCCCAGGG - Intronic
912936930 1:114011804-114011826 GGCTCATACCTGTAATCCCAGGG - Intergenic
915097751 1:153475707-153475729 GGCTCACACCTGTAATCCCAGGG - Intergenic
915161999 1:153927241-153927263 GGCTCACGCCTGTAATCCCAGGG - Intergenic
915235475 1:154477470-154477492 GGCTTATGCCTGTAATCCCAGGG - Intronic
916021708 1:160798330-160798352 TGATCAACCCTGTAATCTCAGGG + Intronic
916085873 1:161268813-161268835 GGCTCACGCCTGTAATCCCAGGG - Intronic
916498544 1:165366876-165366898 GGCTCATGCCTGTACTCTCAGGG - Intergenic
917102661 1:171461519-171461541 GGCTCACACCTGTAATCCCAGGG + Intergenic
917117352 1:171615949-171615971 AGCTCATGCCTGTAATCCCAGGG + Intergenic
917537491 1:175884902-175884924 GCCTAAAGCCTGGAAACTCCTGG + Intergenic
917571157 1:176266808-176266830 GGCTCACGTCTGTAATCCCAGGG - Intergenic
918063476 1:181082862-181082884 GGCGCACGCCTGTAATCCCAGGG + Intergenic
919643362 1:200066842-200066864 GGCTCACGCCTGTAATCCCGAGG - Intronic
919668842 1:200320197-200320219 GGCTCATCCCTGTAATCCCAAGG - Intergenic
919932826 1:202232555-202232577 GGTTCATGCCTGTAATCCCAGGG + Intronic
920231917 1:204476302-204476324 GGCTCATGTCTGTAATCCCAAGG + Intronic
920237984 1:204522054-204522076 GGCCCATGCCTGTAATCCCAGGG + Intronic
920240356 1:204543222-204543244 GGCTCATGCCTGTAATCTCTGGG + Intronic
920302903 1:205000289-205000311 GTCTAAAGCCTAGAATCTCAGGG - Intronic
920862136 1:209718767-209718789 GGCTCATGCCTGTAATCCCAAGG + Intronic
921069235 1:211644917-211644939 AGCTCATGCCTGTAATCTTAGGG - Intergenic
921208021 1:212865942-212865964 GCCAAATGCCTGTAATCCCAGGG - Intronic
921267040 1:213429412-213429434 GGCTCACACCTGTAATCCCAGGG - Intergenic
921762524 1:218932448-218932470 GGCTCACACCTGTAATCCCAGGG - Intergenic
922921395 1:229307863-229307885 GGCTCACGCCTATAATCCCAAGG - Intergenic
923057049 1:230434607-230434629 GGCTTGTGCCTGTAATCCCAGGG + Intergenic
923370670 1:233309273-233309295 GGCTCATGCCTATAATCCCATGG + Intergenic
923620076 1:235571775-235571797 GGCTATACCCTGTAATCTATAGG - Intronic
924095546 1:240547232-240547254 GCCTCATGCCTGTAATCCCAGGG + Intronic
924649994 1:245917290-245917312 GGCTTACGCCTGTAATTCCATGG - Intronic
924754353 1:246928049-246928071 GGCTCACGCCTGTAATCCCAAGG + Intronic
1063321410 10:5055868-5055890 GGCAAAAGCCGGTAATTCCAAGG + Intronic
1063412581 10:5847909-5847931 GGCTCAAGCCTATAATCCTATGG - Intergenic
1063545770 10:6980095-6980117 GGCTCAGTCCTGTAATCTCAGGG - Intergenic
1063615516 10:7596773-7596795 GGCTCATGCCTGTAATCTTTGGG + Intronic
1063706084 10:8432217-8432239 GGCTTATGCCTGTAATCCCAGGG + Intergenic
1063988140 10:11529848-11529870 GGCTCACTCCTGTAATCCCATGG + Intronic
1064045523 10:12011254-12011276 GGCTTATGCCTGTAATACCAGGG - Intronic
1064273373 10:13885116-13885138 AGCTCATGCCTGTAATCCCAGGG + Intronic
1064340735 10:14483189-14483211 GGCTCATGCCTGTAATCCCAGGG - Intergenic
1065057732 10:21863933-21863955 GGCTCAGGCCTTTAATCCCAAGG + Intronic
1065198476 10:23289986-23290008 GGCATAAGCATGTAATTTCATGG - Intronic
1065286171 10:24189746-24189768 GGCTCACTCCTGTAATCCCAAGG + Intronic
1065349341 10:24781737-24781759 GGCTCATGCCTATAATCCCAGGG + Intergenic
1065627890 10:27650051-27650073 GGCTCATGCCTATAATCCCAGGG - Intergenic
1065701638 10:28431503-28431525 GGCTCATGCCTGTAATCCCTTGG + Intergenic
1065741241 10:28799053-28799075 GGCTCATGCCTGTAATCATAGGG + Intergenic
1065937536 10:30534096-30534118 GGCTCACGCCTGTAATTCCAGGG - Intergenic
1065940723 10:30562051-30562073 GGTTCATGCCTGTAATCGCAGGG - Intergenic
1066114420 10:32226928-32226950 GGCTCAGGCCTGTAATCCCAGGG - Intergenic
1066275897 10:33868350-33868372 TGCTCATGCCTGTAATCCCAAGG + Intergenic
1066429024 10:35335588-35335610 GGCTCATGCCCGTAATCCCATGG + Intronic
1066462785 10:35626444-35626466 GGCTCATGCCTGTAATCCCAAGG - Intergenic
1066614289 10:37280271-37280293 GGCAAAAGCCTGTGATTCCAAGG + Intronic
1067002269 10:42627268-42627290 GGCTCATGCCTGTTATCCCAGGG - Intronic
1067357954 10:45548734-45548756 GGCTCATGCCTGTAATCTTCGGG + Intronic
1067729542 10:48800148-48800170 GGCTCACGCTTGTAATCCCAGGG - Intronic
1068017520 10:51535987-51536009 GGCTCATGCCTGTAATCACAGGG - Intronic
1068380475 10:56247530-56247552 GGCTAAAGACTGGAAATTCAAGG + Intergenic
1069479543 10:68769106-68769128 GGCACACGCCTGTAATCCCAGGG - Intronic
1069527140 10:69182259-69182281 GGCTCAGGTCTGTAATCTCAGGG - Intronic
1069974991 10:72205842-72205864 GTCTCACGCCTGTAATCCCAGGG + Intronic
1070019962 10:72575163-72575185 GGCTCACACCTGTAATCCCATGG - Intronic
1070125224 10:73616077-73616099 GGCTCACGCCTGTAATCTTTGGG + Intronic
1070275126 10:74998657-74998679 GGCTCATGCCTGTAATCTTTGGG + Intronic
1070521602 10:77258518-77258540 GGCTAAAGCCTGCAAAAACATGG - Intronic
1070689476 10:78514029-78514051 TGCTCATGCCTGTAATCCCAGGG - Intergenic
1070947779 10:80407876-80407898 GGCTCACGCCTGTAATCTCAGGG - Intronic
1071385777 10:85119968-85119990 GACGAAAGGCTGTAATCTCATGG + Intergenic
1072245664 10:93541906-93541928 GGCCCACGCCTGTAATCTCCAGG - Intergenic
1072664266 10:97382409-97382431 GGCTTATGCCTGTAATCACAGGG - Intronic
1072937863 10:99730792-99730814 GGCTCAAGCCTATAATCCCAAGG + Intronic
1073771345 10:106738858-106738880 GGCTCACGTCTGTAATCCCAGGG + Intronic
1073825055 10:107311445-107311467 GGCTCATGCCTGTAATCCCAGGG + Intergenic
1073987917 10:109230235-109230257 GGCTCACGCCTATAATCTCAGGG - Intergenic
1074367595 10:112871780-112871802 GGCTTACACCTGTAATCCCATGG - Intergenic
1074496642 10:113985397-113985419 GGCTAAAGCCTGACCTCACAGGG + Intergenic
1074683440 10:115934269-115934291 AGTTAAAGCCTGAAATCTCAAGG - Intronic
1076204980 10:128590130-128590152 GGCTTACACCTGTAATCCCAGGG - Intergenic
1076651503 10:131991911-131991933 GGCTCAGGCCTGTAATCCTAGGG + Intergenic
1077246763 11:1543466-1543488 GGCTCACACCTGTAATCCCAAGG - Intergenic
1078138832 11:8675994-8676016 GGCTCACGCCTGTAATCTTTGGG - Intergenic
1078307025 11:10199660-10199682 GGCTCACACCTGTAATCCCAGGG + Intronic
1078311575 11:10248827-10248849 GGCTTACGCCTGTAATCCTAGGG + Intronic
1078567511 11:12429238-12429260 GGCTCATGCCTATAATCCCAGGG - Intronic
1079152219 11:17910224-17910246 GGCTAAATCTTGTAAGTTCAGGG + Intronic
1079182308 11:18204540-18204562 GGGAAAAGCCTGTCTTCTCAGGG - Intronic
1079416761 11:20244973-20244995 GGCTCATGTCTGTAATCCCATGG + Intergenic
1079730911 11:23937210-23937232 GGCAAAAGCCGGTAATTCCAAGG + Intergenic
1080541191 11:33267242-33267264 GGCAGTTGCCTGTAATCTCAAGG - Intronic
1080835103 11:35933359-35933381 GACTAAAGTCTGTGATCTCTGGG + Intergenic
1081135767 11:39438561-39438583 GGCTCATGCCTGTAATCCCAGGG - Intergenic
1081860165 11:46328730-46328752 AGCTCATGCCTGTAATCTCAGGG + Intergenic
1081972409 11:47208719-47208741 GGCTCACGCCTATAATCCCAGGG - Intergenic
1082274883 11:50210880-50210902 GGCTCATGCATGTAATGTCAGGG + Intergenic
1083547110 11:63557263-63557285 GGCTCACACCTGTAATCCCAAGG + Intronic
1083760375 11:64813183-64813205 GGCTCACACCTGTAATCCCAGGG + Intergenic
1083840609 11:65302136-65302158 GGCAGAAGCCTGGGATCTCAGGG - Intronic
1084444915 11:69197956-69197978 GGCTCATGCCTGTGATCCCAAGG + Intergenic
1084797972 11:71520896-71520918 GGCTCATGCCTGCAATCTCAGGG - Intronic
1084921738 11:72476299-72476321 GGCTCCTGCCTGTAATCCCACGG - Intergenic
1085184932 11:74567791-74567813 GGTTCATGCCTGTAATCCCATGG - Intronic
1085675737 11:78515788-78515810 GGCTCAGGGCTGTAATCTCAGGG - Intronic
1086028971 11:82329561-82329583 GGGTAAAGGATGAAATCTCAGGG + Intergenic
1086969191 11:93062080-93062102 ATCTAAATTCTGTAATCTCAGGG + Intergenic
1088311226 11:108462851-108462873 GACTCATGCCTGTAATCCCATGG + Intronic
1089732248 11:120526462-120526484 GGCTCACACCTGTAATCCCAGGG - Intronic
1090784341 11:130036055-130036077 GGCTCATGCCTGTAATCACAGGG + Intergenic
1092341901 12:7684069-7684091 GGCTTACGCCTGTAATTCCAGGG + Intergenic
1092801776 12:12175421-12175443 AGCTCATGCCTGTAATCCCAGGG + Intronic
1093071979 12:14715388-14715410 GGCTCACGCCTGTAATCCCCAGG + Intergenic
1093471266 12:19504504-19504526 GGCTCACACCTGTAATCCCAGGG - Intronic
1094096393 12:26709970-26709992 GGCTCATGCCTATAATCCCAGGG + Intronic
1094577975 12:31705563-31705585 GCCTAAAGCCTGTAATCAAAAGG - Intronic
1095173540 12:39062741-39062763 GGCCAATGCCTGTCATCTCCTGG - Intergenic
1095195770 12:39314669-39314691 GGATAAAGCTTGTAATCTGAAGG - Intronic
1095275675 12:40280355-40280377 GGCTCATGCCTGTAATCCCAGGG + Intronic
1097015514 12:55983924-55983946 GGCCCATGCCTGTAATCCCAGGG - Intronic
1097513144 12:60568290-60568312 GGCTAAACTCTATAGTCTCAGGG + Intergenic
1097738365 12:63209014-63209036 AGCTGAAGCCAGTAATTTCAGGG - Intergenic
1098122049 12:67251815-67251837 GGCTCATGCCTGTAATATCCCGG + Intergenic
1098964090 12:76767651-76767673 GGCTCACGCCTGTAATCCCAGGG + Intronic
1099059447 12:77888223-77888245 GGCTCATGCCTGTAATCCCAAGG + Intronic
1099215639 12:79850076-79850098 GGCTCACACCTGTAATCCCAAGG - Intronic
1099223216 12:79938386-79938408 GGCTCATGCCTGTAATCCCAGGG + Intergenic
1099357568 12:81658001-81658023 GGCTTACACCTGTAATCCCAGGG + Intronic
1099587534 12:84539517-84539539 AGCTAAAAGCTTTAATCTCAAGG - Intergenic
1100275117 12:93064670-93064692 GGCTCATGCTTGTAATCCCAGGG + Intergenic
1100835560 12:98563794-98563816 GGCTCATGCCTGTAATCACAGGG + Intergenic
1101144480 12:101828397-101828419 GGCTCACGCCTGTAATCCCATGG + Intronic
1101722376 12:107361054-107361076 GGCTCACACCTGTAATCCCAGGG - Intronic
1102393332 12:112567357-112567379 GGCTCATGCCTGTAATCCCAGGG + Intergenic
1102818484 12:115887946-115887968 GGCTCACGCCTGTAATCTTTGGG + Intergenic
1102905936 12:116675335-116675357 GGCTCACGCCTGTAATCCCAAGG - Intergenic
1102909736 12:116703774-116703796 GGCTCATGCCTGTAATCCCAGGG + Intergenic
1103091171 12:118099120-118099142 TGCTCAGGCCTGTAATCCCAGGG + Intronic
1103134232 12:118493730-118493752 GGCTTATGCCCATAATCTCAGGG - Intergenic
1103467223 12:121151485-121151507 GGCTCATGCCTGTAATCTTTGGG - Intronic
1103574561 12:121867786-121867808 GGCTGACACCTGTAATCCCAGGG - Intergenic
1103745686 12:123121809-123121831 AGTCCAAGCCTGTAATCTCAGGG - Intronic
1104178885 12:126358590-126358612 TGCTAAAGCCAGTAATTTCTGGG + Intergenic
1104507217 12:129343803-129343825 GGCGTATGCCTGTAATCCCAGGG + Intronic
1105002356 12:132698875-132698897 GGCTCATGCCTGTAATGCCAAGG - Intronic
1105310944 13:19210325-19210347 GTCCAGTGCCTGTAATCTCAGGG + Intergenic
1105361178 13:19717910-19717932 GTCCAGTGCCTGTAATCTCAGGG + Intronic
1105421984 13:20261157-20261179 AGCCATAGCCTGAAATCTCACGG + Intergenic
1105504420 13:20998095-20998117 AGCTGACGCCTGTAATCCCAGGG + Intronic
1105784883 13:23738716-23738738 GGCGCACGCCTGTAATCCCATGG - Intronic
1106085953 13:26541747-26541769 GGCTCATGCCTGTAATCCCAGGG - Intergenic
1106140757 13:27009169-27009191 GGCTATAGCTTGTAACCTCCTGG + Intergenic
1106266242 13:28112823-28112845 GGCTCATGCCTGTAATCTTTGGG + Intergenic
1106477035 13:30107870-30107892 GGCTTATGCTTGTAATCCCAGGG + Intergenic
1106633968 13:31507545-31507567 GGCTCATGCCTGTAATCCTAAGG - Intergenic
1108056839 13:46493743-46493765 GGCTCACGCCTGTATTCCCAGGG - Intergenic
1108122091 13:47199957-47199979 GGTTCATGCCTGTAATCCCAGGG + Intergenic
1108182616 13:47855751-47855773 GGCTTATGCCTGTAATCCCAGGG - Intergenic
1108205533 13:48085455-48085477 GGCTAATGCCTGTAATCCCAGGG - Intronic
1108265549 13:48704256-48704278 GGCCCACGCCTATAATCTCACGG + Intronic
1108454784 13:50602123-50602145 GGCTCATACCTGTAATCCCAGGG - Intronic
1108917816 13:55637447-55637469 GGCTCACGCCTATAATCCCAAGG + Intergenic
1110441945 13:75536138-75536160 GGCTCATGACTGTAAGCTCAGGG - Intronic
1110588737 13:77228237-77228259 GGTTCACACCTGTAATCTCAGGG + Intronic
1110859012 13:80327437-80327459 GGCTTACGCCTGTAATCCCAGGG - Intergenic
1111833383 13:93357577-93357599 GGCTCAAGCCTGTAATGTTTTGG + Intronic
1112519439 13:100082643-100082665 GGCAAAAGCCGGTAATTCCAAGG - Intergenic
1112538693 13:100285162-100285184 GGCCAAAGCCAGTAATTCCAAGG - Intronic
1112576422 13:100640584-100640606 GGCTCATGCCTGTAACCCCAAGG + Intronic
1113262231 13:108577284-108577306 GGCTAAAGGCTGGATTCTCGAGG + Intergenic
1113834159 13:113317954-113317976 GGCTCATGCCTGTAATTCCAGGG - Intronic
1114178451 14:20344550-20344572 GGCTCACGCCTGTAATCCCTTGG + Intronic
1114624781 14:24121906-24121928 GGCTCATGCCTGTAACCCCAGGG + Intronic
1115559466 14:34570199-34570221 GGCACATGCCTGTAATCTCAAGG - Intronic
1115617189 14:35106622-35106644 GGCTCACGCCTGTATTCCCAAGG - Intronic
1115637623 14:35305832-35305854 GGCTCATGCCTGTAATCCTAAGG + Intronic
1115714682 14:36089986-36090008 GGCTTACGCCTGTAATCCCAGGG + Intergenic
1116296234 14:43113846-43113868 GTCTAAAGCCTGAAAACTTAGGG - Intergenic
1117125866 14:52625215-52625237 GGCTCACACCTGTAATCCCAGGG + Intronic
1117259280 14:54013875-54013897 GGCTCATGCCTGTAATCCCTTGG - Intergenic
1117819395 14:59631991-59632013 GCCTAAGGACAGTAATCTCAAGG + Intronic
1118012391 14:61623109-61623131 GGCTCACGCCAGTAATCCCAGGG + Intronic
1118214261 14:63793668-63793690 GGCTCATGCCTATAATCCCAGGG + Intergenic
1118629790 14:67692193-67692215 AGCTGAAGCCAGAAATCTCATGG - Intronic
1119289933 14:73487613-73487635 GGCTCATGCTTGTAATCCCAGGG + Intronic
1119876728 14:78066225-78066247 GGCTTCAGCCTTTACTCTCAGGG - Intergenic
1120282929 14:82462401-82462423 GTTTAAAGCCTGTCATTTCATGG - Intergenic
1120504486 14:85337709-85337731 GGCTTACGCCTGTAATCTTTGGG + Intergenic
1120785023 14:88526012-88526034 GGCTCATACCTGTAATCCCAAGG + Intronic
1121029836 14:90648616-90648638 GGCTTATGCCTGTAATCCCAGGG - Intronic
1121649755 14:95549265-95549287 GGCTCATGCCTGTAATCCCAGGG - Intergenic
1122684501 14:103494417-103494439 GGCACATGCCTGTAATCCCAGGG + Intronic
1123046042 14:105515455-105515477 GGCTCACGCCTGTAATCCCCAGG - Intergenic
1123724467 15:23088280-23088302 GGCTCATGCCTATAATCCCAAGG - Intergenic
1123772691 15:23544915-23544937 GGCTCACGCCTGTAATCCCAGGG + Intergenic
1123951006 15:25274652-25274674 GGCTCACGCCTGTGATCCCAGGG - Intergenic
1124156238 15:27227217-27227239 AGCTCATGCCTGTAATCCCAGGG + Intronic
1124180879 15:27472540-27472562 GGCTCACACCTGTAATCCCAGGG - Intronic
1125118729 15:36126688-36126710 GGCTAACACCAGTTATCTCAAGG - Intergenic
1125637257 15:41199216-41199238 AGCTCATGCCTGTAATCCCAAGG - Intronic
1125645410 15:41268378-41268400 GGCTCATGCCTGTAATCCCAGGG + Intronic
1126026555 15:44451374-44451396 GGCTCACACCTGTAATCCCAGGG - Intronic
1127032600 15:54880429-54880451 GGCTCACACCTGTAATCCCAGGG - Intergenic
1127469930 15:59281830-59281852 GGCTCATGCCTGTAATCCCAGGG + Intronic
1127494552 15:59497587-59497609 GTCTCATGCCTGTAATCCCAGGG + Intronic
1127948946 15:63785500-63785522 GGCTAACACCTGTAATCCCAAGG + Intronic
1128124340 15:65180971-65180993 GGCTCATGCCTGTAATCCCAGGG + Intronic
1128138902 15:65285049-65285071 GGCTCATGCCTGTAATCCCAAGG - Intronic
1128173800 15:65535954-65535976 GGTTCAAGCCTGTAACCTCAGGG - Intronic
1128492829 15:68167085-68167107 GGCTCACGCCTGTAATCCCAAGG - Intronic
1129069520 15:72939070-72939092 GGCTCAAGCCTATAATATCCAGG + Intergenic
1129314380 15:74732330-74732352 GGCTCACGCCTATAATCCCAGGG - Intergenic
1129998816 15:80029664-80029686 AGCTTACGCCTGTAATCCCAAGG - Intergenic
1130581901 15:85145180-85145202 GGCTCATGCCTGTAGTCCCAGGG + Intergenic
1130788751 15:87129194-87129216 GCCTCACACCTGTAATCTCAAGG + Intergenic
1131391023 15:92048959-92048981 GGCTAAAGCCAATCATTTCATGG - Intronic
1132195504 15:99911773-99911795 GGCTCATGCCTGTAATCCCAGGG - Intergenic
1132357644 15:101184614-101184636 GGCTCACGTCTGTAATCCCAGGG - Intronic
1133038608 16:3047726-3047748 GGCTCATGCCGGTAATCCCAGGG + Intronic
1133800300 16:9079985-9080007 GGCTCATGCCTGTAATCCCAGGG + Intergenic
1134003556 16:10801714-10801736 GGCTCATGCCTGTAATCTTTTGG - Intronic
1134005441 16:10815953-10815975 GGCTCATGCCTGTAATCCCAAGG + Intronic
1134145156 16:11754941-11754963 GGCTCATGCCTGTAATCCCACGG + Intronic
1134171878 16:11975858-11975880 GACTCATGCCTGTAATCCCAAGG - Intronic
1134285037 16:12853934-12853956 GGCTCACGCCTGTAATCCCTTGG - Intergenic
1134599117 16:15519648-15519670 GGCTCACACCTGTAATCCCAAGG - Intronic
1134636157 16:15793557-15793579 GGCTTATGCCTGGAAACTCAGGG - Intronic
1134661358 16:15986906-15986928 GGCTCACGCCTGTAATCCTAAGG + Intronic
1135191990 16:20361964-20361986 GGCCAATGACTGTAATCCCAAGG + Intronic
1135202479 16:20450490-20450512 GGCTCATGCCTGTAATCTTTGGG + Intergenic
1135216625 16:20577376-20577398 GGCTCATGCCTGTAATCTTTGGG - Intergenic
1135524684 16:23205436-23205458 GGCTCATGCCTGTAATCTTTGGG + Intronic
1135791792 16:25403437-25403459 GGCTCACGCCTGTAATCCCAAGG - Intergenic
1135792010 16:25405662-25405684 GGCTCATGCCTGTAATCCCAGGG + Intergenic
1136185515 16:28586286-28586308 GGCTCATGCCTGCAATCGCAAGG + Intronic
1136467756 16:30456774-30456796 GGCTCATGCCTGTATTCCCAGGG - Intergenic
1136644275 16:31596207-31596229 GGCTAAACTCTGTAATCACTTGG - Intergenic
1136660847 16:31760366-31760388 GGCTAAACTCTGTAATCACTTGG + Exonic
1137291370 16:47054289-47054311 GGCTCACACCTGTAATCTTAAGG - Intergenic
1137612449 16:49827864-49827886 GGCTCACGCCTATAATCCCAGGG - Intronic
1138061453 16:53895341-53895363 GGCTTAAGCCTGAATTCTCTTGG - Intronic
1138494365 16:57398561-57398583 GGCAAAAGCCAGTGATCCCAAGG + Intergenic
1138732120 16:59206847-59206869 GGCTCATGCTTGTAATCCCAGGG + Intergenic
1138894847 16:61190966-61190988 GGCTCACACCTGTAATCCCAGGG - Intergenic
1138989756 16:62376843-62376865 GGCACACGCCTGTAATCCCAAGG - Intergenic
1139509495 16:67418821-67418843 GGCTCATGCCTGCAATCCCATGG - Intergenic
1139825156 16:69751272-69751294 GGCTTATGCCTATAATCCCAGGG - Intronic
1139906598 16:70370578-70370600 GGCTCATGCCTGCAATCCCAAGG + Intronic
1140085682 16:71793982-71794004 TGCTCATGCCTGTAATCCCAGGG - Intronic
1140305368 16:73797936-73797958 GGCGAGCGCCTGTAATCCCAGGG - Intergenic
1140350803 16:74260475-74260497 GGTGCACGCCTGTAATCTCAGGG + Intergenic
1140411884 16:74746064-74746086 GGCTCATGCCTGTAATCCCAAGG - Intronic
1140492412 16:75349242-75349264 GGGTCACACCTGTAATCTCAAGG + Intronic
1140603417 16:76505766-76505788 GGCTCAAACCTATAATCCCAGGG + Intronic
1140826028 16:78707614-78707636 GTCTCATGCCTGTAATCCCAGGG + Intronic
1141169732 16:81683647-81683669 GGCTCATGCCTGTAATCTTTGGG - Intronic
1141372373 16:83500067-83500089 GGCTCACACCTGTAATCCCAGGG - Intronic
1141567499 16:84912915-84912937 GGCTCACACCTGTAATCCCAGGG - Intronic
1142068453 16:88076010-88076032 GGCTCATGCCTATAATCCCAGGG - Intronic
1142200006 16:88756533-88756555 GGCTCAAGCCCGCCATCTCATGG + Intronic
1142419241 16:89960375-89960397 GGCTCACGCCTGTAATCCTAGGG + Intronic
1143010478 17:3863605-3863627 GGCTCATGCCTGTAATCACCTGG + Intronic
1143024120 17:3930879-3930901 GGCTCATGCCTGTCATCCCAGGG + Intronic
1143160544 17:4867277-4867299 GGCTCATACCTGTAATCTCAGGG + Intronic
1143636413 17:8166238-8166260 GGCGGACGCCTGTAATCCCAGGG - Intergenic
1144085456 17:11804610-11804632 GGCTCACGCCTGTAATCCCAGGG + Intronic
1144130345 17:12240747-12240769 GGCTCAAGCCTATAATCCCAGGG + Intergenic
1144202516 17:12954162-12954184 GGCTCATGCCTGTAATCTCAGGG - Intronic
1144422040 17:15107691-15107713 GGCTCACACCTGTAATCCCAGGG + Intergenic
1144709244 17:17389477-17389499 GGCTCACACCTGTAATCCCAGGG - Intergenic
1144736454 17:17558238-17558260 GGCTCATGCCTGCAATCCCAGGG + Intronic
1144741383 17:17584425-17584447 GGCTCACGCCTGTAATCCCTCGG - Intronic
1145090557 17:19982459-19982481 GGCTCATGCCTGTAATCTTTGGG + Intergenic
1145856818 17:28167493-28167515 GGCTCATGCCCGTAATCCCAGGG - Intronic
1145891665 17:28420712-28420734 GGCTCACACCTGTAATCCCAGGG + Intergenic
1146105899 17:30036691-30036713 GGCTCACGCCTGTAATCCCAGGG - Intronic
1146728503 17:35174551-35174573 GGCTCATGCCTGTAATCCCAGGG + Intronic
1146771554 17:35572917-35572939 GGCTCAAGCCTGTGATCCCAGGG + Intergenic
1147205576 17:38835048-38835070 GGCTCCATCCTCTAATCTCAGGG + Intergenic
1147739801 17:42664979-42665001 GGCTCAGGCCTGTAATCCCAAGG - Intronic
1148000995 17:44387025-44387047 GGCTCACGCCTGTAATCCCTTGG - Intronic
1148426585 17:47603149-47603171 GGCTCATGCCTGTAATCCCAGGG + Intronic
1148493874 17:48040337-48040359 GGGTCACACCTGTAATCTCAGGG - Intergenic
1148941579 17:51217861-51217883 GGCTCACACCTGTAATCCCAGGG - Intronic
1149066950 17:52491960-52491982 GGCTAAATCTTGTCAACTCATGG - Intergenic
1149087801 17:52740187-52740209 GGCTCAGGCCTGTAATCCCAGGG + Intergenic
1149209992 17:54290860-54290882 GGCAAAAGCCGGTGATCCCAAGG - Intergenic
1149213535 17:54329518-54329540 GGCAAAAGCCGGTGATCCCAAGG - Intergenic
1149219490 17:54399683-54399705 GACTAAATGCTGCAATCTCATGG + Intergenic
1149519490 17:57307703-57307725 GGCTCATGCCTATAATCCCAAGG - Intronic
1149803220 17:59589975-59589997 GGCTCATGCCTGCAATCCCAAGG - Intronic
1149843268 17:59985514-59985536 GGCTCATGCCTGCAATCCCAAGG + Intergenic
1149864346 17:60142250-60142272 GGCTTGTGCCTGTAATCCCAGGG + Intergenic
1150201786 17:63364653-63364675 GGCTTATGCCTGTAATCCCAGGG + Intronic
1150230511 17:63547263-63547285 GGCTCATGCCTGTAATCCCAGGG + Intronic
1150299336 17:64035574-64035596 GGCTCACGCCTCTAATCTCAGGG + Intergenic
1150354588 17:64472212-64472234 GGCTCACGTCTGTAATCCCATGG + Intergenic
1150706837 17:67494702-67494724 GGCTCACGCCTGTAATCCCCAGG + Intronic
1151537640 17:74748009-74748031 GGCTCACGTCTGTAATCCCAGGG + Intergenic
1151642052 17:75403506-75403528 GGCTCATGTCTGTAATCCCAAGG + Intronic
1151751756 17:76042981-76043003 GGCTCATGCCTCCAATCTCAAGG + Intronic
1151800877 17:76378973-76378995 GGCTCATGCCTGTAATCCCAGGG + Intronic
1152093566 17:78259631-78259653 GGCTCACGCCTGTAACCCCAGGG + Intergenic
1152413365 17:80142777-80142799 GGCTCACGCCTGTAATCCCAAGG + Intronic
1152589750 17:81205628-81205650 GGCTCAAACCTGTAATCCCAGGG + Intronic
1152816972 17:82413601-82413623 GGCTCATGCCTGTAACCCCAGGG + Intronic
1153153289 18:2120394-2120416 GGCTCACGCCTGTAATCCCAAGG - Intergenic
1153883113 18:9437873-9437895 GGCTCATGTCTGTAATCCCAAGG - Intergenic
1153883402 18:9440089-9440111 GGCTCACACCTGTAATCCCAGGG + Intergenic
1153993951 18:10423502-10423524 GGCTCATGCCTGTAATCCCAGGG + Intergenic
1155098200 18:22580551-22580573 GGCTCATGCCTGTAATCCCAGGG + Intergenic
1155179574 18:23332159-23332181 GGCTCACGCCTGTAATCCCAGGG - Intronic
1155305349 18:24472886-24472908 GGCTCATGCCTGTAATCCCAGGG + Intronic
1156332830 18:36140618-36140640 GGCTCATGCCTGTAATCCTAGGG - Intronic
1156620484 18:38845812-38845834 GGCTCACACCTGTAATCCCAAGG + Intergenic
1157687888 18:49657444-49657466 GGCTCACACCTGTAATCCCAGGG + Intergenic
1157961232 18:52155404-52155426 GGCACATGCCTGTAATATCAGGG - Intergenic
1158248156 18:55454918-55454940 GGCTCACGCCTGTAATCCCAGGG + Intronic
1158705875 18:59791196-59791218 GGCTCACGCCTGTAATCCCTGGG - Intergenic
1159139595 18:64376966-64376988 GGCTCACACCTGTAATCCCAGGG - Intergenic
1159232334 18:65625539-65625561 GGCTGAAGCCTGTATTACCAGGG + Intergenic
1159710372 18:71750857-71750879 GGCTCACACCTGTAATCCCAGGG + Intronic
1160721453 19:598872-598894 GGCTCACGCCTGTAATTCCAGGG - Intronic
1161308405 19:3579617-3579639 GGCTCACGCCTGTAATCCCAGGG - Intergenic
1161680296 19:5676752-5676774 GGATAAAGCCTGTGACCCCAGGG + Intronic
1161702218 19:5801909-5801931 GGCTCATGCCTGAAATCCCAGGG - Intergenic
1161712829 19:5859444-5859466 GGCTCACGCTTGTAATCCCAGGG - Intergenic
1161981123 19:7630941-7630963 GGCTCATGCTTGTAATCCCAGGG + Intronic
1162129678 19:8518617-8518639 GGCTCACGCCTGTAATCCCAGGG - Intergenic
1162141530 19:8588350-8588372 GGCTCACACCTGTAATCCCAGGG - Intronic
1162331770 19:10034276-10034298 GGCTCACACCTGTAATCCCAGGG + Intergenic
1162339109 19:10081119-10081141 GGCTCATGCCTGTAATCTCAGGG + Intergenic
1162420133 19:10561424-10561446 GGCTCATGCCTGTAATCTCAGGG - Intronic
1162803995 19:13127229-13127251 GGCTCATGCCTATAATCGCAGGG + Intronic
1162848532 19:13412982-13413004 GGCTCACGCCTGTAATCCCAAGG + Intronic
1162892712 19:13745523-13745545 GGCGCATGCCTGTAATCCCAGGG + Intronic
1162912327 19:13854972-13854994 GGCTCACGCCTGTAATCTTGCGG - Intergenic
1162920796 19:13901437-13901459 GGCTCATGCCTGTAATCTTTGGG + Intronic
1163036906 19:14575203-14575225 GGCTAACGACTGTAATTACACGG + Intergenic
1163309186 19:16502723-16502745 GGCTCACACCTGTAATCCCAGGG + Intronic
1163540446 19:17906070-17906092 GGCTCATGCCTATAATCCCAGGG + Intergenic
1163731567 19:18952639-18952661 GGCTCACACCTGTAATCCCAGGG + Intergenic
1163808502 19:19415419-19415441 GGCTCACGTCTGTAATCCCAGGG - Intronic
1163882324 19:19936100-19936122 GGCTCATGCCTGTAATGTCAAGG + Intergenic
1164640212 19:29819412-29819434 GGCTCATGCCTGTAGTCCCAAGG - Intronic
1165417443 19:35703475-35703497 GGCTCATGCCCGTAATCCCAGGG - Intergenic
1165661854 19:37587850-37587872 GGCTCACGCCTGTAGTCCCAGGG + Intronic
1165747331 19:38237684-38237706 AGCTCATGCCTGTAATCGCAGGG - Intergenic
1165969608 19:39615619-39615641 GGCTCATGACTGTAATCCCAGGG - Intergenic
1166025580 19:40081264-40081286 GGCTCACACCTGTAATCCCAGGG + Intronic
1166135593 19:40775341-40775363 GGGTAAAGGCTGTAAGCCCAAGG - Intronic
1166154974 19:40904186-40904208 GGCTCACGCCTGTAATCCCAGGG + Intergenic
1166173099 19:41046146-41046168 GGCTCACGCCTGTAATCCCAGGG - Intergenic
1166376455 19:42330187-42330209 GGCTCACGTCTGTAATCCCAGGG - Intronic
1166535182 19:43569204-43569226 GGCTCATGTCTGTAATCCCAAGG + Intronic
1166724607 19:45018921-45018943 GGCTCACGCCTGTAATCTGGCGG - Intronic
1166964433 19:46519723-46519745 GGCTCACGCCTGTAATCCCCAGG + Intronic
1167088228 19:47324894-47324916 GGCTCACACCTGTAATCCCAGGG + Intergenic
1167090759 19:47342086-47342108 GGCTCACGCCTGTAATTCCAGGG + Exonic
1167174663 19:47857529-47857551 GGCTCATGCATGTAATCCCAGGG - Intergenic
1167214128 19:48152928-48152950 GGCTCACGCCTGTAATCCCAGGG + Intronic
1167252621 19:48408550-48408572 GGCTCACACCTGTAATCTCAGGG + Intronic
1167273650 19:48521491-48521513 GGTTTATGCCTGTAATCCCAGGG - Intergenic
1167395161 19:49223672-49223694 GGCTCATGCCTGTAATCTCAGGG - Intergenic
1167447260 19:49544933-49544955 GGTTCACGCCTGTAATCCCAAGG + Intronic
1167564268 19:50246410-50246432 GGCTCACGCCCGTAATCCCAGGG - Intronic
1167614571 19:50525346-50525368 GGCTCAGGGCTGTAATCCCAAGG - Intronic
1167753123 19:51392775-51392797 GGCTCATGACTGTAATCTCTTGG - Intergenic
1167865136 19:52319128-52319150 GGCTCACACCTGTAATCTCAGGG - Intronic
1168293166 19:55366921-55366943 GGCTCACTCCTGTAATCCCAAGG - Intronic
925043286 2:750782-750804 GGCTCAGGCCCGTAATCTCAGGG - Intergenic
925244476 2:2368555-2368577 AGCCAAAGCCTCTAAACTCACGG - Intergenic
926001217 2:9334320-9334342 GGCTCATGCCTATAATCCCAGGG - Intronic
927631585 2:24778901-24778923 GGCTCACGCCTGTAATCCCAAGG - Intergenic
928617317 2:33053619-33053641 GGCAAAAGCCAGTAATTCCAAGG + Intronic
929696552 2:44121764-44121786 GGCTCATGCTTGTAATCCCAGGG + Intergenic
930447203 2:51488959-51488981 GGCTCATGCCTGTAATCCCAGGG - Intergenic
930577662 2:53171576-53171598 GGCTCACGCCTGTAATCCCGAGG + Intergenic
931332680 2:61304160-61304182 AGCTCATGCCTGTAATCCCAAGG - Intronic
932697301 2:73967676-73967698 GGCTCACACCTGTAATCTCTTGG + Intergenic
933667876 2:84979260-84979282 GGCTTATGCCTGTAATCCCATGG + Intronic
933672143 2:85018534-85018556 GGCTCATGCCTGTAATCCCAGGG - Intronic
934671908 2:96219522-96219544 GGCAGAAGCCTGTTATGTCAAGG + Intergenic
934883412 2:98003961-98003983 GGCTTAAGCTTGTGATTTCAGGG - Intergenic
935010318 2:99129005-99129027 GGCTCATGCCTGTAATCCCAGGG - Intronic
935029909 2:99311731-99311753 GGCTCATGCCTGTAATCCCAGGG - Intronic
935037037 2:99387172-99387194 GGCTCATGCCTGAAATCCCAGGG - Intronic
935283776 2:101545341-101545363 GTCTAAACCCTGTAATCAAAAGG - Intergenic
935654898 2:105413744-105413766 GGCTCACACTTGTAATCTCAGGG - Intronic
936341775 2:111640108-111640130 GGCTCCTGCCTGTAATCCCAGGG + Intergenic
936802349 2:116284334-116284356 GGCAAAAGCCGGTGATCCCAAGG - Intergenic
937479750 2:122245601-122245623 GGCTCAAGCCTTCAGTCTCATGG + Intergenic
938922711 2:136009671-136009693 GGCTCACGCCTGTAATCCCAGGG - Intergenic
939633883 2:144557865-144557887 TGCTTATGCCTGTAATCCCAGGG - Intergenic
939833441 2:147100104-147100126 GGATAAAGCCTGAAGTCACAGGG - Intergenic
940343573 2:152605589-152605611 GGCTCACACCTGTAATCCCAGGG - Intronic
940375629 2:152955000-152955022 GGCTCATGCCTGTAATCCCAGGG + Intergenic
940414771 2:153406672-153406694 GGCTCATTCCTGTAATCCCAGGG - Intergenic
940669424 2:156649162-156649184 GGCTTACACCTGTAATCCCAGGG - Intergenic
941410013 2:165143016-165143038 GGCTCATGCCTGTAATCTCAGGG - Intronic
941841381 2:170088307-170088329 GGATAAAACCTATAATCTAATGG - Intergenic
941903238 2:170697390-170697412 GGCTCATGCCTGTAATCTTTGGG + Intergenic
942527527 2:176870485-176870507 GGCTCATGCCTGTAATTCCAGGG - Intergenic
943070695 2:183137326-183137348 GGCTCATGCCTGTAATCCCGAGG + Intronic
943298830 2:186172531-186172553 GGCTCATGCCTGTAATCCAAAGG + Intergenic
943475390 2:188347882-188347904 GGCTCATGCCTGGAATCCCAGGG - Intronic
943799615 2:192041941-192041963 GGCTCATGCCTGTAATCCCATGG + Intronic
944186774 2:196957696-196957718 GGCTCAGGCCTGTAATCCCAGGG - Intergenic
944567394 2:201004747-201004769 GGCTCACGCCTGTAATCCCTCGG + Intronic
944680183 2:202070187-202070209 GACTCACGCCTGTAATCCCAAGG + Intergenic
944709183 2:202320381-202320403 GGTTCAAGCCTGTATTCTCAGGG - Intergenic
944729301 2:202501274-202501296 GGCAAAAGCCGGTAATTCCAAGG - Intronic
945109837 2:206351707-206351729 GGCTTATGCTTGTAATCCCAGGG + Intergenic
945429218 2:209745188-209745210 GGCTCATGCCTGTAATTCCAGGG - Intergenic
945597752 2:211816272-211816294 GGCTCATGCCTGTAATCCCAGGG + Intronic
946232824 2:218303212-218303234 GGCTCACACCTGTAATCCCAAGG - Intronic
946240734 2:218353655-218353677 GGCTTACACCTGTAATCCCATGG - Intergenic
946630497 2:221662424-221662446 GGCTCACACCTGTAATCTCAGGG - Intergenic
946907874 2:224433318-224433340 GGCTCACGGCTGTAATCCCAGGG - Intergenic
948271615 2:236678273-236678295 GGCTCATGCCTGTAAACCCAAGG - Intergenic
948937020 2:241173023-241173045 GGCTCACACCTGTAATCCCAAGG + Intronic
949013006 2:241692566-241692588 GGCTCATGCCTGCAATCCCAGGG - Intergenic
1169063004 20:2675112-2675134 GGCTCAGGCCTGTAGTCCCAGGG - Intergenic
1169067146 20:2700488-2700510 GGCCAAAGTCTTTGATCTCATGG - Intronic
1169132132 20:3171825-3171847 GGCAACAGGCTGTCATCTCAGGG - Intronic
1169522219 20:6386234-6386256 GGCTCATGCTTGTAATCCCAAGG + Intergenic
1170837174 20:19894516-19894538 GGCTCATGCCTGAAATCCCAGGG - Intronic
1171483851 20:25473339-25473361 GGCTCACACCTGTAATTTCAAGG + Intronic
1172120003 20:32592761-32592783 GGCTCATACCTATAATCTCATGG + Intronic
1172426269 20:34858354-34858376 ATCTAAAGCCAGTAATCTCCTGG + Intronic
1172492350 20:35350257-35350279 GGCTCATGCCTATAATCCCAGGG - Intronic
1172761191 20:37323676-37323698 GGCTCACGCCTATAATCCCAAGG - Intergenic
1173819832 20:46012824-46012846 GGCTCACGCCTCTAATCCCAGGG + Intronic
1173878145 20:46389582-46389604 GGCTCATGCATGTAATCCCAAGG + Intronic
1174658106 20:52188581-52188603 GGCTCACTCCTGTAATCCCAGGG - Intronic
1175039133 20:56029029-56029051 GGCTCATGCCTGTAACCCCAGGG - Intergenic
1175264693 20:57695531-57695553 GGCTCACGCCTGTAATCTTTGGG + Intronic
1175461663 20:59156264-59156286 GGCTCCCGCCTGTAATCCCAGGG + Intergenic
1176217439 20:63954982-63955004 GGCTCACGCCTGTAATCCCACGG + Intronic
1176516769 21:7790103-7790125 GGCTCCTGCCTGTAATCCCAGGG - Intergenic
1177844284 21:26270599-26270621 GGCTCATGACTGTAATCCCAGGG - Intergenic
1177887970 21:26769047-26769069 GGCTCACACCTGTAATCCCAAGG + Intergenic
1178339457 21:31773733-31773755 GGCTCATGCTTGTTATCTCAGGG + Intergenic
1178457130 21:32765872-32765894 GGCTCACGCCTGTAATCCCCTGG + Intronic
1178476538 21:32942310-32942332 GGCTCACACCTGTAATCCCAGGG + Intergenic
1178650797 21:34420115-34420137 GGCTCCTGCCTGTAATCCCAGGG - Intronic
1178846724 21:36180300-36180322 GGCTCATGCCTGTAATCCCAGGG + Intronic
1178957163 21:37032923-37032945 GGCTCACGCCTGTAATCCCAGGG - Intergenic
1178977021 21:37228763-37228785 GGCTCAGGCCCGTAATCCCAGGG + Intronic
1179001834 21:37468371-37468393 GGCTCATGCCTGTAATTGCAGGG - Intronic
1179634809 21:42701685-42701707 GGCTCACGTCTGTAATCTCAGGG - Intronic
1179663247 21:42891985-42892007 GGCTCACACCTGTAATCCCAGGG + Intronic
1180222926 21:46370637-46370659 GGCTCATGCCTGTAATCCCAGGG + Intronic
1180657236 22:17432846-17432868 GGCTCACACCTGTAATCACAGGG - Intronic
1180756902 22:18168651-18168673 GGCTCATGCCTGTAATCCCAGGG - Intronic
1181074867 22:20368792-20368814 GTCTCATGCCTGTAATCCCAAGG + Intronic
1181590273 22:23879952-23879974 AGCTCACGCCTGTAATCCCAGGG + Intronic
1181656786 22:24307803-24307825 GGCTCACACCTGTAATCCCAAGG - Intronic
1181721180 22:24775749-24775771 GGCTCACGCCTGTAATCCCAAGG - Intergenic
1182136782 22:27912713-27912735 GGCTCATGCTTGTAATCCCAAGG + Intronic
1182312702 22:29420593-29420615 GGCTCATGCCTGTAATCCCAAGG - Intronic
1182611791 22:31554102-31554124 GGCTCATGACTGTAATCCCAGGG - Intronic
1182729174 22:32473953-32473975 GCCTACAGTTTGTAATCTCATGG + Intergenic
1182830151 22:33298554-33298576 GGCTCACGCCTGTAATCCTAGGG + Intronic
1183208865 22:36437771-36437793 GGCTCAAGCCTGGAAGGTCAAGG - Intergenic
1183333207 22:37232373-37232395 GGCTAAGGCCGGTAATCAGATGG - Intronic
1183562829 22:38589978-38590000 GGCTCACACCTGTAATCCCAGGG + Intronic
1184056010 22:42050057-42050079 GGCTCATGCCTGTAATCTTTGGG + Intronic
1185300946 22:50080664-50080686 GGCTCATGCCTGTAATCGCAGGG - Intronic
949186493 3:1198454-1198476 GGCTCATGCCTGTAATCTCAGGG + Intronic
949449942 3:4174428-4174450 GGCTCATGCCTGTTATCCCAGGG + Intronic
951494426 3:23310615-23310637 GGCTTCTACCTGTAATCTCAAGG + Intronic
951773334 3:26282731-26282753 GGCTCAAGCCTGTAATCCCAGGG + Intergenic
952295004 3:32053840-32053862 GGCATGTGCCTGTAATCTCAAGG + Intronic
952462983 3:33549021-33549043 GGCTCACACCTGTAATCCCAAGG - Intronic
952763518 3:36935743-36935765 GGCCAAAGCCTGAATTCTTAAGG + Intronic
953952001 3:47198536-47198558 GGTTCACGCCTGTAATCCCAAGG + Intergenic
954255585 3:49403446-49403468 GGCTCATGCCTATAATCCCAGGG + Intronic
954899452 3:54006573-54006595 GGCTCTTGCCTGTAATCCCAAGG - Intergenic
954904824 3:54051750-54051772 GGCGCAAACCTGTAATCCCAGGG + Intergenic
955153210 3:56389605-56389627 AGGTCAAGCCTGTGATCTCAAGG + Intronic
955995383 3:64675416-64675438 GGCTCAGTCCTGTAATCCCAGGG + Intronic
956711926 3:72046745-72046767 GGCTTATGCCTGTAATTCCAGGG + Intergenic
958016007 3:87941275-87941297 GGCAGAAGCCTGTAATGCCAAGG + Intergenic
958440552 3:94151205-94151227 GGCTCACACCTGTAATCTCAGGG + Intergenic
958773478 3:98454295-98454317 GGCTCACACCTGTAATCCCAGGG + Intergenic
959984476 3:112557367-112557389 GGCTCAAGCCTGTAATCCCGAGG + Intronic
960002744 3:112749775-112749797 GGCTTAAGCCAATTATCTCATGG + Intronic
960089262 3:113622919-113622941 GGCTCACGGCTGTAATCCCAGGG + Intronic
960123376 3:113970424-113970446 GGCTCATGGCTGTAATCCCAGGG - Intronic
960638443 3:119806550-119806572 GGCTGATGCCTGTAATCCCGGGG - Intronic
960797409 3:121501856-121501878 GGCGCATGCCTGTAATCCCAGGG + Intronic
960869814 3:122237369-122237391 GGCTCATGCCTATAATCCCAAGG - Intronic
961580608 3:127878257-127878279 GGCTCATGCTTGTAATCCCAGGG - Intergenic
961683670 3:128615667-128615689 GGCTTAAGGCAGTGATCTCATGG - Intergenic
961835367 3:129653711-129653733 GGCGCACGCCTGTAATCCCAGGG - Intronic
962108083 3:132414422-132414444 GGCTGACACCTGTAATCCCAAGG - Intergenic
962239720 3:133742246-133742268 GGCTCATGCCTGTAATCCTAGGG - Intergenic
963202796 3:142601781-142601803 GGTTCATGCCTGTAATCTCAGGG - Intronic
963209478 3:142673295-142673317 GGCTCACACCTGTAATCCCAAGG - Intronic
963352656 3:144170724-144170746 GGCTCAAGCCTGTAATCCCCAGG - Intergenic
963992007 3:151666585-151666607 GGCAAAAGCCGGTGATTTCAAGG + Intergenic
964795323 3:160490730-160490752 AGCTGATGCCTGTAATCCCAGGG - Intergenic
964816922 3:160727610-160727632 GGCTCACGCCTGTAATCTCATGG + Intergenic
964844725 3:161032959-161032981 GGCTCATGCCTGTAATCCCGAGG - Intronic
965539088 3:169854248-169854270 GGATAAAACCCTTAATCTCAAGG + Intronic
966364244 3:179165521-179165543 GGCTCATGCCTGCAATCTTAAGG - Intronic
966542413 3:181106869-181106891 GGCTCATGCCTGTAATCCCAGGG + Intergenic
966720140 3:183054146-183054168 GGCTCATACCTGTAATCCCAGGG - Intronic
966997073 3:185293375-185293397 GGCTCACGCCTGTAATCCCAGGG - Intronic
967818152 3:193816244-193816266 GGCTCACGCCTGTAATCTTTGGG + Intergenic
968040148 3:195581906-195581928 GGCTCAAGCCTGTAATCCCATGG + Intronic
968347692 3:198024479-198024501 GGCTCACGCCTGTAATCCCAGGG - Intronic
969369079 4:6719911-6719933 GGCTCATGCCTGTATTCCCAGGG + Intergenic
970899594 4:21143476-21143498 GGCTACTGCCTGGAATCTCTGGG - Intronic
971018726 4:22513776-22513798 GGCTCACACCTGTAATCCCAGGG - Intronic
971471588 4:27032302-27032324 GGCTCACGCCTGTAATCACGAGG - Intergenic
972377678 4:38488104-38488126 GGCTCATGCCTGTAATCCCAGGG - Intergenic
972430189 4:38974334-38974356 GGCTCATGCCTGTAATCTCAGGG - Intronic
972474233 4:39435382-39435404 GGCTCATGCCTGTAATCCCAGGG - Intronic
973938288 4:55874741-55874763 GGCAAGAGCCTATAATTTCAGGG - Intronic
974048240 4:56915180-56915202 GGCTCACGCCTGTAATCTTTGGG - Intronic
975862253 4:78690095-78690117 GGCTCACGACTGTAATCCCAGGG - Intergenic
976372913 4:84310856-84310878 GGGTCATGACTGTAATCTCATGG + Intergenic
976741936 4:88365439-88365461 GGCTCATGCCTGTAATCCCAGGG - Intergenic
976901285 4:90179647-90179669 GGCTCACGCCTGTAATCCCAAGG - Intronic
977134385 4:93284293-93284315 CACTAAAGCCTGTCATCACATGG + Intronic
977372492 4:96157212-96157234 GACCAAAGCCTGTAATATTAAGG - Intergenic
977381801 4:96283859-96283881 GGCAAACACCTGTAATCCCAGGG - Intergenic
977903298 4:102447771-102447793 GGCTCACGCCTGTAATCAGAGGG - Intergenic
978180586 4:105790390-105790412 GGCTTATGCCTGTATTCCCAGGG + Intronic
978761564 4:112359297-112359319 GGCTACAGCCTGTAGACTCCAGG - Intronic
978782770 4:112574763-112574785 GGCTCATGTCTGTAATCCCATGG + Intronic
979387535 4:120087030-120087052 GGCTCATGCCTGTAATCCCAAGG + Intergenic
980396792 4:132225366-132225388 GGCTCATGCCTGTAATCCCAGGG + Intergenic
981515437 4:145603509-145603531 CCCTAAAGCCAGTAGTCTCAAGG - Intergenic
981831296 4:149005175-149005197 GCCTAAAGCCTGGAATTTGAGGG + Intergenic
981958729 4:150510002-150510024 GGCACATGCCTGTAATCCCAGGG + Intronic
982309440 4:153969225-153969247 GGTTCATGCCTGTAATCACAAGG + Intergenic
982710571 4:158754850-158754872 GGTTCATGCCTGTAATCCCAAGG + Intergenic
983017043 4:162626377-162626399 GGCTCAAGCCTGTAATCCCAGGG - Intergenic
983198684 4:164837150-164837172 GGCTCATACCTGTAATCCCAAGG + Intergenic
983272205 4:165575441-165575463 GGCTCATGCCTGTAATCTCTTGG - Intergenic
983433910 4:167687160-167687182 GGCTAAATCATGTAAATTCAAGG + Intergenic
984986319 4:185333782-185333804 GGCTCATGCCTGTAATCTTTGGG + Intronic
985176052 4:187202496-187202518 GGCTCATGCCTGTAATCCCAGGG + Intergenic
986109272 5:4695126-4695148 TGATAAAGCCAGGAATCTCAAGG + Intergenic
986723507 5:10577387-10577409 GGCTCACGCCTGTAATCTACGGG - Intronic
987344146 5:16964026-16964048 GGCTCACCCTTGTAATCTCACGG - Intergenic
987503205 5:18739606-18739628 GGCTTATGCCTATAATCCCAGGG - Intergenic
988311858 5:29569011-29569033 GGCTCATGCCTGTAATCCCAGGG - Intergenic
988451386 5:31347036-31347058 GGCTTATGCCTGTAATCCCGTGG - Intergenic
988462146 5:31449475-31449497 GGCTCACGCCTGTAATCCTAAGG + Intronic
988580428 5:32463963-32463985 GGCTCACGCCTGTAATCTCAGGG - Intergenic
988663667 5:33301439-33301461 GGCTCATGCCTGTAATCCCAGGG - Intergenic
989074549 5:37550129-37550151 GGTTCACGCCTGTAATCCCAGGG - Intronic
989308770 5:39988301-39988323 GGCTCACACCTGCAATCTCAGGG - Intergenic
989589946 5:43104093-43104115 GGCTCATGCCTGTCATCCCAGGG - Intronic
989957617 5:50374706-50374728 GGCAAAAGCCAGTAATTCCAAGG - Intergenic
990766538 5:59189978-59190000 GGCTAAAGCCTGAAACATCTTGG - Intronic
991611152 5:68450870-68450892 GGCTCACACCTGTAATCCCAGGG + Intergenic
992043694 5:72863348-72863370 GGCTCACACCTGTAATCCCAAGG + Intronic
992649766 5:78847391-78847413 GTCTCATGCCTGTAATCTCAGGG - Intronic
992961625 5:81961234-81961256 GGCTCACACCTGTAATCCCAGGG - Intergenic
993466753 5:88257007-88257029 GGCTAAAGCCTGTAATCTCAGGG + Intronic
994529015 5:100942751-100942773 GGCTCACGCCTGTAATCCCGAGG - Intergenic
994697542 5:103091715-103091737 GGCTCACGCCTATAATCCCAGGG + Intronic
995569202 5:113461536-113461558 GGCTCATGCCTGTAATCCCAGGG + Intronic
995611725 5:113917595-113917617 GGCTCATGCCTGTAATCCCGAGG - Intergenic
995705007 5:114979704-114979726 GGCTCATGCCTGTAATCCCAGGG + Intergenic
995807386 5:116068656-116068678 GGCTCACACCTGTAATCCCAGGG - Intergenic
996316681 5:122168302-122168324 GGCTCACGCCTGTCATCCCAGGG - Intronic
997249051 5:132374787-132374809 GGCTCTTGCCTGTAATCCCAGGG + Intronic
997334234 5:133093747-133093769 GGCTCATGCCTGTAATCCCAGGG - Intronic
997435871 5:133874865-133874887 GGCTCACACCTGTAATCTCAAGG - Intergenic
997500320 5:134368776-134368798 GGCTCACACCTGTAATCCCAGGG + Intronic
997791644 5:136767478-136767500 GGCTCATGCCTGTAATCCCAGGG + Intergenic
997941469 5:138161574-138161596 GGCTCACGCCTGTAATCTTTGGG - Intronic
997995191 5:138579546-138579568 GGCTACAGCCTGAAGGCTCAAGG + Intergenic
997998165 5:138603215-138603237 GGCTGACTCCTGTAATCTCGGGG - Intergenic
998462829 5:142322210-142322232 GGCTCACGCCTGTAATCCCAGGG + Intronic
998587435 5:143441954-143441976 GGCTCATGCCTATAATCACAGGG - Intergenic
998835770 5:146201771-146201793 GGCTCATGCCTGTATTCCCAGGG - Intergenic
998836972 5:146211726-146211748 GGCTCACACCTGTAATCCCAGGG - Intronic
999814734 5:155164507-155164529 GGCTCATGCCTGTAATCCCAGGG + Intergenic
999988590 5:157028101-157028123 GGCTCATGCCTGTAATCCCAGGG - Intergenic
1000494721 5:161967481-161967503 GGCTACCACCTGTAATCACAGGG + Intergenic
1001291697 5:170467649-170467671 GGCTCACGCCTGTAATCCCAGGG + Intronic
1001367144 5:171153779-171153801 GGCTCATGCCTGTAATCTTCAGG + Intronic
1001592594 5:172875832-172875854 GGCTCATGCCTGTTATCCCAAGG - Intronic
1001727382 5:173917465-173917487 GGCTCACGCCTGTAATCCCAGGG + Intronic
1001735041 5:173990385-173990407 GGCTCATGCATGTAATCCCAGGG - Intronic
1002358900 5:178654025-178654047 GGCTCACGTCTGTAATCCCAGGG - Intergenic
1002611941 5:180425645-180425667 GGCTCACGCTTGTAATCCCAGGG - Intergenic
1002612047 5:180426524-180426546 GGCTCACGCTTGTAATCCCAGGG - Intergenic
1003269001 6:4590968-4590990 TGCTAAAACCTGTAATGGCAGGG - Intergenic
1003297030 6:4838939-4838961 GGCTCACGCCTGTAATCCCAAGG - Intronic
1004196071 6:13506525-13506547 GGCTCATGCCTGTAATCCCAGGG - Intergenic
1004383246 6:15150273-15150295 GGCTCATGCCTATAATCCCAGGG - Intergenic
1004467632 6:15900800-15900822 GGCTCACGCCTGTAATCACGAGG - Intergenic
1004669429 6:17781892-17781914 AGCTTATGCCTGTAATCCCAGGG - Intronic
1004693626 6:18013784-18013806 GGCTCACGCCTGTAATCCGAAGG - Intergenic
1005352541 6:24950417-24950439 TGCACAATCCTGTAATCTCATGG + Intronic
1005635030 6:27744959-27744981 GGCTCACGCCTGTAATCCCAGGG - Intergenic
1005873067 6:29991467-29991489 AGCTAAAGACGTTAATCTCATGG + Intergenic
1005911984 6:30318655-30318677 GGCTCATGCCTGTAATCCCAGGG + Intergenic
1006452524 6:34113400-34113422 GGCTCAGGCCTGTAATCCCGAGG - Intronic
1006470389 6:34225399-34225421 GGCTCACGCCTGTAATCTCAGGG - Intergenic
1006589290 6:35142220-35142242 GGCTCGAGCCTGTCATCCCAGGG + Intronic
1006938957 6:37738723-37738745 GGCTCACGCCTGTAATCCCAGGG + Intergenic
1007426673 6:41750727-41750749 GGCTCATGCCTGTAATCCCAGGG + Intronic
1007459730 6:42009343-42009365 GGCTCACACCTGTAATCCCAGGG + Intronic
1008867849 6:56236285-56236307 GTCTAAAGCCTGGAAACTCCAGG + Intronic
1009407444 6:63328881-63328903 GGCAAAAGCCGGTAATTCCAAGG + Intergenic
1009723770 6:67509621-67509643 GGCTAATGTCTGTAATCCCAGGG + Intergenic
1010026080 6:71218784-71218806 GGCTCATGCCTGTAATCTCCAGG - Intergenic
1010139236 6:72594608-72594630 GGCTCACACCTGTAATCCCAAGG - Intergenic
1010219714 6:73437806-73437828 GGCTCATGCCTGTAATCTTTGGG + Intronic
1010422236 6:75688651-75688673 GGCTCATACCTGTAATCCCAGGG + Intronic
1010970127 6:82254046-82254068 GGCTCACGCTTGTAATCCCAGGG + Intergenic
1010990850 6:82478484-82478506 GGCTAATGCCTCTAATCCCTTGG - Intergenic
1012468207 6:99539064-99539086 GGCTTATGCCTGTAATCCCAGGG + Intergenic
1012892964 6:104918144-104918166 GGCTCATGCCTGTAATCTCAGGG + Intergenic
1012908340 6:105092674-105092696 GGCTCACGCCTGTAATCTCAAGG - Intergenic
1013201646 6:107903432-107903454 GGCTCATGACTGTAATCCCAGGG + Intronic
1013386978 6:109641433-109641455 GGCTCACACCTGTAATCCCATGG - Intronic
1013776707 6:113687043-113687065 AGCTCATGCCTGTAATCCCAGGG - Intergenic
1014457163 6:121649137-121649159 GCCAAAAGCCTATACTCTCAGGG + Intergenic
1014543830 6:122708897-122708919 GGCTCATGCCTGTAATCTCAGGG - Intronic
1015066955 6:129041734-129041756 GGCTGATGCCTGTAATCCCAGGG + Intronic
1015534962 6:134258344-134258366 GGCTCATGCCTGTAACCCCAGGG - Intronic
1015998687 6:139020704-139020726 GGCTCATGTGTGTAATCTCAGGG + Intergenic
1017332474 6:153215881-153215903 GGCTCATGCCTGTAATCTTTGGG + Intergenic
1017511200 6:155115850-155115872 GGCTCACGCCTGTAATCTATGGG + Intronic
1017585662 6:155919708-155919730 GGCTCATGCCTCTAATCCCAGGG - Intergenic
1017854217 6:158335009-158335031 GGCTCAGGCCTGTAGTCCCAGGG + Intronic
1019688598 7:2396705-2396727 GGCTCACACCTGTAATCCCATGG + Intergenic
1019765324 7:2845348-2845370 GGCTCACGCCTTTAATCTTAAGG - Intergenic
1019792629 7:3026774-3026796 GGCTCACACCTGTAATCCCAGGG - Intronic
1019997252 7:4732582-4732604 GGCTCATGCCCGTAATCCCACGG - Intronic
1020113359 7:5460717-5460739 GGCTCACGGCTGTAATCCCAGGG - Intronic
1020621496 7:10525404-10525426 GGCTCATGCCTGTAATCCCAGGG - Intergenic
1021038258 7:15828312-15828334 GGCGTATGCCTGTAATCCCATGG + Intergenic
1023107034 7:36772717-36772739 GGCTAAAGCCTGTAGGTTCTTGG - Intergenic
1023169512 7:37377101-37377123 GGCAAAATCATGTGATCTCATGG + Intronic
1023296932 7:38724856-38724878 GGCTCACGCCCGTAATCCCAGGG - Exonic
1023305052 7:38817335-38817357 GGCTCACGCCTGTCATCCCAGGG + Intronic
1023426771 7:40044900-40044922 GGCTCATGCCTGTAATCCCAGGG - Intronic
1023434153 7:40125047-40125069 GGCTCACGCCTGTAATCCCAGGG + Intergenic
1023592180 7:41792064-41792086 GGTTCACGCCTGTAATCCCAGGG - Intergenic
1024264361 7:47595465-47595487 GGCTCATGCCTGTGATCTCAAGG + Intergenic
1024273045 7:47656797-47656819 GGCTCACGCCTGTAATCCCAGGG + Intronic
1024994738 7:55264402-55264424 GGCTCACACCTGTAATCCCAAGG - Intergenic
1025019535 7:55469917-55469939 GGCTCATGCCTGTAATCCCACGG + Intronic
1025144030 7:56489460-56489482 GGCTCATGCCTATAATCCCAGGG - Intergenic
1025788887 7:64669274-64669296 GGCTCATGCCTGTAATCCCTTGG - Intronic
1025829204 7:65035205-65035227 GGCTCACACCTGTAATCCCAAGG + Intergenic
1025916419 7:65870161-65870183 GGCTCACACCTGTAATCCCAAGG + Intergenic
1026055797 7:66982647-66982669 GGTTCATGCCTATAATCTCAGGG + Intergenic
1026079448 7:67204851-67204873 GGCTCATGCCTGTAATCCCAGGG - Intronic
1026200823 7:68213218-68213240 GGCTCACACCTGTAATCCCAGGG + Intergenic
1026486723 7:70828429-70828451 GGCTCACACCTGTAATCCCAGGG - Intergenic
1026515584 7:71068001-71068023 GGCTTATGCCTGTAATCCCAGGG - Intergenic
1026697392 7:72607131-72607153 GGCTCATGCCTGTAATCCCAGGG + Intronic
1026890982 7:73982338-73982360 GGCTACAGGCTGGAATCTCCAGG - Intergenic
1026893257 7:73995524-73995546 GACTCACGCCTGTAATCCCAGGG + Intergenic
1026930067 7:74218962-74218984 GGCTCACACCTGTAATCCCAGGG - Intronic
1027024547 7:74841433-74841455 GGCTCATGGCTGTAATCACAGGG - Intronic
1027063218 7:75102689-75102711 GGCTCATGGCTGTAATCACAGGG + Intronic
1027258968 7:76450388-76450410 GGCTAATGCCTGTAATCCCAAGG - Intergenic
1027310341 7:76948469-76948491 GGCTAATGCCTGTAATCCCAAGG - Intergenic
1027564700 7:79776796-79776818 GGCTTACACTTGTAATCTCAGGG + Intergenic
1027618864 7:80457949-80457971 GGCTCATGCCTGTAATTCCAGGG + Intronic
1027650983 7:80868533-80868555 GGCTCACACCTGTAATCCCAAGG - Intronic
1029148329 7:98462731-98462753 GGCTCATGCTTGTAATCCCAGGG - Intergenic
1029252825 7:99249278-99249300 GGCTCACACCTGTAATCCCAGGG + Intergenic
1029264039 7:99324887-99324909 GGCTCACACCTGTAATCTGAGGG + Intergenic
1029478262 7:100798041-100798063 GGCTCATGCCTGTAATCACAGGG - Intergenic
1029703293 7:102261848-102261870 GGCTCACACCTGTAATCCCAAGG + Intronic
1030041092 7:105450773-105450795 GGCTCACGCCTGTAATCCCAGGG + Intronic
1032120542 7:129152425-129152447 GGCTCATGCCTGTAATCTTTTGG + Intronic
1033649816 7:143332232-143332254 GGCTCATGCCTCTAATCCCATGG - Intronic
1034064274 7:148121297-148121319 GGCTCACGCCTGTAATCCTAGGG - Intronic
1034077021 7:148242006-148242028 GGCTAAAGCTTGTAAGACCAAGG + Intronic
1034184132 7:149161285-149161307 GACTCAAGCCTGTAATTCCAGGG + Intronic
1034527102 7:151672062-151672084 GGCTCACGCCTGTAATCCCAGGG - Intronic
1035450219 7:158973098-158973120 GGCTCACCCCTGTAATCCCACGG - Intergenic
1036045453 8:5135074-5135096 GGCTCAGGCCTGTAATCCCAGGG - Intergenic
1036291503 8:7496564-7496586 GGCTCATGCCTGTAATCCCAGGG - Intronic
1036329986 8:7814979-7815001 GGCTCATGCCTGTAATCCCAGGG + Intronic
1036471380 8:9055804-9055826 GGCTCATGCCTGTAATCCCAGGG - Intronic
1036812530 8:11877380-11877402 GGCTCACTCCTGTAATCCCATGG + Intergenic
1037782544 8:21880310-21880332 GGCTCACGCCTATAATCCCAGGG + Intergenic
1037919979 8:22799002-22799024 GGCTAACTCCTGTAATCCCAGGG - Intronic
1038255032 8:25943198-25943220 GGCTCATGCCTGTAATCTCAGGG + Intronic
1038629474 8:29227680-29227702 GGCTCACGCCTGTAATCCCAGGG + Intronic
1039071657 8:33654416-33654438 GGCTCATGCCTGTAATCCTAGGG + Intergenic
1039164759 8:34665417-34665439 GGCTCATGCCTGTAATCCCAGGG - Intergenic
1039630674 8:39108015-39108037 GGCTCACGCCTGTAATCCCAGGG + Intronic
1039701480 8:39966291-39966313 GGCTCAGGCCTGTAATCCCAGGG - Intronic
1039932580 8:42007694-42007716 GGCTCAAGCCTGTAATCCCAGGG + Intronic
1039988351 8:42466934-42466956 AGCTCATGCCTGTAATCCCAGGG - Intronic
1040859365 8:51983460-51983482 GGCTCACACCTGTAATCCCAGGG - Intergenic
1040964800 8:53072725-53072747 GGCAAAAGCCAGTAATTCCAAGG + Intergenic
1040971205 8:53139207-53139229 GGCAAAAGCCTGTGATTCCAAGG + Intergenic
1041217013 8:55610845-55610867 GGTTCATGCCTGTAATCCCAGGG - Intergenic
1042170923 8:65990051-65990073 GGCTCAAGCCTGTAATCCCAGGG - Intergenic
1042172554 8:66006239-66006261 AGAGAAAGCCTGAAATCTCATGG - Intergenic
1042228286 8:66532340-66532362 GGCACATGCCTGTAATCCCAGGG - Intergenic
1042314312 8:67409465-67409487 GGCTCATGCCTGTAATCCCAGGG + Intergenic
1042596011 8:70449070-70449092 GGTTCACGCCTGTAATTTCAGGG - Intergenic
1042653819 8:71072900-71072922 GGCTTGAGCCTGTAATCCCAGGG + Intergenic
1043009529 8:74864570-74864592 GGCTAACGCTTGTAATTTTAGGG + Intergenic
1043578652 8:81687082-81687104 GGCTCATGCCTGTAATCTTTGGG - Intergenic
1044895332 8:96885727-96885749 GGCTCACGCCTGTAATCTCAGGG + Intronic
1045100746 8:98841557-98841579 GGCTCATGCCTGTAACCCCATGG + Intronic
1045755572 8:105537407-105537429 GGCTTATGTCTGTAATCCCAGGG + Intronic
1046266421 8:111837082-111837104 GTCTAAAGCCTGGAATCACAGGG - Intergenic
1046756884 8:117981588-117981610 GGCTCATGGCTGTAATCCCATGG + Intronic
1048178737 8:132176207-132176229 GTATCAAGCCTGTAATTTCATGG + Intronic
1049723523 8:144133440-144133462 GGCTCACGCCTGTAATCCCGGGG + Intergenic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1051308204 9:15739302-15739324 GGCTAATGCCTGTATACTAAAGG + Intronic
1051357735 9:16255020-16255042 GGCTAAAGCCTGTCCTCTGCAGG + Intronic
1051499232 9:17758993-17759015 GGCTGAAGCCAGTGGTCTCAGGG - Intronic
1052613689 9:30810819-30810841 GGCTTATGCCTGTAATCCTAGGG + Intergenic
1053156030 9:35780002-35780024 GGCTCATGCCTGTAAGCCCAAGG - Intergenic
1053193015 9:36089866-36089888 GACTCAAGCCTGTAATTCCAGGG + Intronic
1053258542 9:36640714-36640736 GGCTCATGCCTGTAATCCCAGGG - Intronic
1053300245 9:36943917-36943939 GGCTCACACCTGTAATCTCAGGG + Intronic
1053532312 9:38894869-38894891 GGCTCAAGACTGTAATCTTTGGG + Intergenic
1054828371 9:69596251-69596273 GGCTCACACCTATAATCTCAGGG - Intronic
1055077245 9:72228901-72228923 AGTTATAGCCTGTAATTTCAGGG + Intronic
1055270905 9:74557204-74557226 GGCTTAAGCCAGTCATCACATGG + Intronic
1055323451 9:75104276-75104298 GGCTCACACCTGTAATCCCAGGG + Intronic
1056644459 9:88398831-88398853 GGCTCACGCCTGTAATCCCAGGG - Intronic
1056763679 9:89431762-89431784 GGCTCACACCTGTAATCACAGGG - Intronic
1056925573 9:90831307-90831329 AGCAGAAGCCTGGAATCTCAGGG + Intronic
1057722493 9:97544269-97544291 GGTTCATGCCTGTAATCCCAGGG + Intronic
1057755820 9:97834122-97834144 GGTTAAAGCCTGGCATCGCAGGG + Intergenic
1057991194 9:99771873-99771895 GGCTCATGCCTGTAATCCCAAGG - Intergenic
1058366856 9:104219328-104219350 GGCTCATGCCTGTAATCCCAGGG + Intergenic
1059231194 9:112723018-112723040 GGCTAACACCTGTAATCCCTGGG + Intergenic
1060331615 9:122676546-122676568 GACCATAGCCTGTAGTCTCATGG - Intergenic
1060388534 9:123257546-123257568 GGCTCATGCCTGTAATCCCAGGG + Intronic
1060679916 9:125553269-125553291 GGCTCATGCCTGTAATCCCAGGG + Intronic
1061472873 9:130841371-130841393 GGCTCACGCCTGTAATCCCAGGG - Intronic
1061624302 9:131832314-131832336 GGCTCACACCTGTAATCCCAGGG + Intergenic
1062177385 9:135171310-135171332 GGCTCACGCCTGTAATCCCAGGG + Intergenic
1186588979 X:10908774-10908796 GGCTAAAGCTTGCAATTTTAAGG - Intergenic
1187031003 X:15488144-15488166 GGCGCATGCCTGTAATCCCAGGG + Intronic
1187144350 X:16624055-16624077 GGCTCACGCCTGTAATCCTAAGG - Intronic
1187198568 X:17112224-17112246 GGCTCACACCTGTAATCCCAAGG - Intronic
1188482298 X:30648339-30648361 GGCTCATGCCTGTATTCCCAGGG - Intergenic
1188572098 X:31600197-31600219 GGCTCATGCCTGTAATCCCAAGG - Intronic
1189152544 X:38723351-38723373 GGCTCATGCCTGTAATCCCAGGG + Intergenic
1189279303 X:39810033-39810055 GGCTCATGGCTGTAATCCCAGGG - Intergenic
1189484377 X:41418057-41418079 GGCTCATGCCTGTAATCCTAAGG - Intergenic
1189532570 X:41901781-41901803 GCCTAAAGCCTGTATTCACAGGG + Intronic
1190307482 X:49093395-49093417 GGCTCAAGCCTGTAATCCCAGGG - Intronic
1190309351 X:49105811-49105833 GGCTCACGCCTGTAATCCCAGGG + Intergenic
1190357023 X:49615217-49615239 GACTCACACCTGTAATCTCAGGG - Intergenic
1192486274 X:71529567-71529589 GGATAAAGCCTCTCATCTAAAGG + Intronic
1192882967 X:75307153-75307175 GGCTCAAACATGTGATCTCATGG - Intergenic
1193097110 X:77562811-77562833 GGCTCAGGCCTGCAATCCCAGGG - Intronic
1193511278 X:82402924-82402946 GGCTTGTGCCTGTAATTTCAGGG - Intergenic
1193558332 X:82984695-82984717 AGCTAATGCCTGTAGTCCCATGG - Intergenic
1194298445 X:92155892-92155914 GGCTCACGCCTGTAATCCCAGGG - Intronic
1194642120 X:96414631-96414653 GGCTCACGCCTGTAATCCCTGGG + Intergenic
1195611298 X:106870295-106870317 GGCTCACGCCTGTAATCCCAGGG - Intronic
1196670476 X:118361474-118361496 GGCTCATGCCTGTAATCCCGAGG + Intronic
1196701937 X:118679192-118679214 GGTTCATGCCTGTAATCTGAGGG - Intronic
1197737265 X:129860888-129860910 GGCTCATGCCTGTAATCACAGGG + Intergenic
1198054501 X:132980612-132980634 GGCTCAAGCCTGTAATCTTTTGG + Intergenic
1198082342 X:133251748-133251770 GGCTTACGGCTGTAATCCCAGGG + Intergenic
1198083799 X:133264375-133264397 GGCTCATGCCTATAATCCCAGGG + Intergenic
1198089164 X:133310858-133310880 GGCTCATGCCTATAATCCCAGGG + Intronic
1198250103 X:134871418-134871440 GGCTCATGCCTGTAATCCAAGGG + Intergenic
1198485936 X:137087499-137087521 CGTTCAAGCCTGTAATCCCAAGG - Intergenic
1198547566 X:137708913-137708935 GGCTCACACCTGTAATCCCAGGG - Intergenic
1200616051 Y:5380853-5380875 GGCTCACGCCTGTAATCCCAGGG - Intronic
1200776452 Y:7174159-7174181 GGCAAAAGCCAGTGATCCCAAGG - Intergenic
1200789815 Y:7289376-7289398 GGCTCATGCCTATAATCCCAGGG + Intergenic
1201407294 Y:13661995-13662017 GGCAAAAGCCAGTGATCCCAAGG + Intergenic
1201472956 Y:14353561-14353583 GGCAAAAGCTTGTGATCCCAAGG + Intergenic
1201642440 Y:16193910-16193932 GGCTCATGCCTGTAATCTGGAGG + Intergenic
1201660374 Y:16391410-16391432 GGCTCATGCCTGTAATCTGGAGG - Intergenic
1201727107 Y:17165973-17165995 GGCTCATGCCTGTAATCCCAGGG - Intergenic
1201787136 Y:17797182-17797204 GGCTCATGCCTGTAATCTGAGGG + Intergenic
1201814417 Y:18108806-18108828 GGCTCATGCCTGTAATCTGAGGG - Intergenic
1201865874 Y:18653733-18653755 GGCTCACACCTGTAATCCCAGGG + Intergenic
1202271781 Y:23080558-23080580 GGCAAAAGCCAGTAATTCCAAGG + Intergenic
1202294245 Y:23340124-23340146 GGCAAAAGCCAGTAATTCCAAGG - Intergenic
1202331260 Y:23755866-23755888 GGCTCATGCCTGTACACTCAGGG + Intergenic
1202348988 Y:23966807-23966829 GGCTCACACCTGTAACCTCAGGG + Intergenic
1202424778 Y:24714302-24714324 GGCAAAAGCCAGTAATTCCAAGG + Intergenic
1202446011 Y:24955783-24955805 GGCAAAAGCCAGTAATTCCAAGG - Intergenic
1202521787 Y:25703297-25703319 GGCTCACACCTGTAACCTCAGGG - Intergenic
1202539510 Y:25914194-25914216 GGCTCATGCCTGTACACTCAGGG - Intergenic