ID: 993468312

View in Genome Browser
Species Human (GRCh38)
Location 5:88274725-88274747
Sequence ATGTCCTTCAAGAAGAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993468312_993468313 6 Left 993468312 5:88274725-88274747 CCTTATTTCTTCTTGAAGGACAT No data
Right 993468313 5:88274754-88274776 ATATTTCTTCGAATATCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993468312 Original CRISPR ATGTCCTTCAAGAAGAAATA AGG (reversed) Intergenic
No off target data available for this crispr