ID: 993472703

View in Genome Browser
Species Human (GRCh38)
Location 5:88325324-88325346
Sequence GCACCCAACAAGTTTCAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993472699_993472703 20 Left 993472699 5:88325281-88325303 CCAGTGAGAAACATCTCACTGGG No data
Right 993472703 5:88325324-88325346 GCACCCAACAAGTTTCAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993472703 Original CRISPR GCACCCAACAAGTTTCAGTA TGG Intergenic
No off target data available for this crispr