ID: 993476535

View in Genome Browser
Species Human (GRCh38)
Location 5:88373269-88373291
Sequence CCATTACCACCCAAAGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993476535_993476540 6 Left 993476535 5:88373269-88373291 CCAAGGGCTTTGGGTGGTAATGG No data
Right 993476540 5:88373298-88373320 ATGTTGATTAGGAGAAGCACAGG No data
993476535_993476543 23 Left 993476535 5:88373269-88373291 CCAAGGGCTTTGGGTGGTAATGG No data
Right 993476543 5:88373315-88373337 CACAGGGGAATGTTTTAAAGTGG No data
993476535_993476542 8 Left 993476535 5:88373269-88373291 CCAAGGGCTTTGGGTGGTAATGG No data
Right 993476542 5:88373300-88373322 GTTGATTAGGAGAAGCACAGGGG No data
993476535_993476539 -5 Left 993476535 5:88373269-88373291 CCAAGGGCTTTGGGTGGTAATGG No data
Right 993476539 5:88373287-88373309 AATGGTTTGGGATGTTGATTAGG No data
993476535_993476541 7 Left 993476535 5:88373269-88373291 CCAAGGGCTTTGGGTGGTAATGG No data
Right 993476541 5:88373299-88373321 TGTTGATTAGGAGAAGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993476535 Original CRISPR CCATTACCACCCAAAGCCCT TGG (reversed) Intergenic
No off target data available for this crispr