ID: 993479631

View in Genome Browser
Species Human (GRCh38)
Location 5:88408333-88408355
Sequence ATGTGTGACAAAAACGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993479626_993479631 -6 Left 993479626 5:88408316-88408338 CCTTTCTTTACCACCACATGTGT No data
Right 993479631 5:88408333-88408355 ATGTGTGACAAAAACGGAGTGGG No data
993479625_993479631 -5 Left 993479625 5:88408315-88408337 CCCTTTCTTTACCACCACATGTG No data
Right 993479631 5:88408333-88408355 ATGTGTGACAAAAACGGAGTGGG No data
993479624_993479631 12 Left 993479624 5:88408298-88408320 CCAAAGATTTTTCTCTTCCCTTT No data
Right 993479631 5:88408333-88408355 ATGTGTGACAAAAACGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993479631 Original CRISPR ATGTGTGACAAAAACGGAGT GGG Intergenic
No off target data available for this crispr