ID: 993480072

View in Genome Browser
Species Human (GRCh38)
Location 5:88413708-88413730
Sequence TCCTGTCGAAGTATGTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993480071_993480072 -3 Left 993480071 5:88413688-88413710 CCACATCTATTCTCTATTTTTCC No data
Right 993480072 5:88413708-88413730 TCCTGTCGAAGTATGTCTGCTGG No data
993480070_993480072 5 Left 993480070 5:88413680-88413702 CCTCTCTTCCACATCTATTCTCT No data
Right 993480072 5:88413708-88413730 TCCTGTCGAAGTATGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993480072 Original CRISPR TCCTGTCGAAGTATGTCTGC TGG Intergenic