ID: 993482938

View in Genome Browser
Species Human (GRCh38)
Location 5:88447673-88447695
Sequence CTGGTCCAGGGTAAGGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993482938_993482945 8 Left 993482938 5:88447673-88447695 CCACAGACCTTACCCTGGACCAG No data
Right 993482945 5:88447704-88447726 CAACACTGGAGAAGATGAAAAGG No data
993482938_993482942 -6 Left 993482938 5:88447673-88447695 CCACAGACCTTACCCTGGACCAG No data
Right 993482942 5:88447690-88447712 GACCAGACTTCAACCAACACTGG No data
993482938_993482947 17 Left 993482938 5:88447673-88447695 CCACAGACCTTACCCTGGACCAG No data
Right 993482947 5:88447713-88447735 AGAAGATGAAAAGGAGGCCTTGG No data
993482938_993482948 18 Left 993482938 5:88447673-88447695 CCACAGACCTTACCCTGGACCAG No data
Right 993482948 5:88447714-88447736 GAAGATGAAAAGGAGGCCTTGGG No data
993482938_993482946 11 Left 993482938 5:88447673-88447695 CCACAGACCTTACCCTGGACCAG No data
Right 993482946 5:88447707-88447729 CACTGGAGAAGATGAAAAGGAGG No data
993482938_993482949 19 Left 993482938 5:88447673-88447695 CCACAGACCTTACCCTGGACCAG No data
Right 993482949 5:88447715-88447737 AAGATGAAAAGGAGGCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993482938 Original CRISPR CTGGTCCAGGGTAAGGTCTG TGG (reversed) Intergenic
No off target data available for this crispr