ID: 993485621

View in Genome Browser
Species Human (GRCh38)
Location 5:88480601-88480623
Sequence ATGTTTGCCTTTAAGATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993485621_993485625 11 Left 993485621 5:88480601-88480623 CCTAAAATCTTAAAGGCAAACAT No data
Right 993485625 5:88480635-88480657 AATCTACTTCTGGAATTTGTGGG No data
993485621_993485624 10 Left 993485621 5:88480601-88480623 CCTAAAATCTTAAAGGCAAACAT No data
Right 993485624 5:88480634-88480656 AAATCTACTTCTGGAATTTGTGG No data
993485621_993485622 1 Left 993485621 5:88480601-88480623 CCTAAAATCTTAAAGGCAAACAT No data
Right 993485622 5:88480625-88480647 TTCCTTTTCAAATCTACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993485621 Original CRISPR ATGTTTGCCTTTAAGATTTT AGG (reversed) Intergenic
No off target data available for this crispr