ID: 993486889

View in Genome Browser
Species Human (GRCh38)
Location 5:88497779-88497801
Sequence CTGGGTATGAGTGCTGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993486889_993486896 12 Left 993486889 5:88497779-88497801 CCTGCATCAGCACTCATACCCAG No data
Right 993486896 5:88497814-88497836 TATGAAGTGGTCCTCCTGTTTGG No data
993486889_993486893 -1 Left 993486889 5:88497779-88497801 CCTGCATCAGCACTCATACCCAG No data
Right 993486893 5:88497801-88497823 GGCCGTCCTGTTTTATGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993486889 Original CRISPR CTGGGTATGAGTGCTGATGC AGG (reversed) Intergenic
No off target data available for this crispr