ID: 993487266

View in Genome Browser
Species Human (GRCh38)
Location 5:88502290-88502312
Sequence CTGGTTCATCATTGCACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993487265_993487266 -6 Left 993487265 5:88502273-88502295 CCAGACAAGGAGTTTTTCTGGTT No data
Right 993487266 5:88502290-88502312 CTGGTTCATCATTGCACTGCAGG No data
993487263_993487266 -3 Left 993487263 5:88502270-88502292 CCACCAGACAAGGAGTTTTTCTG No data
Right 993487266 5:88502290-88502312 CTGGTTCATCATTGCACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993487266 Original CRISPR CTGGTTCATCATTGCACTGC AGG Intergenic
No off target data available for this crispr