ID: 993502467

View in Genome Browser
Species Human (GRCh38)
Location 5:88678734-88678756
Sequence GTGGAGAGAGGGTCTGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993502460_993502467 -4 Left 993502460 5:88678715-88678737 CCAAAGTGCCCTGCGCGCGGTGG No data
Right 993502467 5:88678734-88678756 GTGGAGAGAGGGTCTGCTGAGGG No data
993502459_993502467 -3 Left 993502459 5:88678714-88678736 CCCAAAGTGCCCTGCGCGCGGTG No data
Right 993502467 5:88678734-88678756 GTGGAGAGAGGGTCTGCTGAGGG No data
993502458_993502467 -2 Left 993502458 5:88678713-88678735 CCCCAAAGTGCCCTGCGCGCGGT No data
Right 993502467 5:88678734-88678756 GTGGAGAGAGGGTCTGCTGAGGG No data
993502456_993502467 18 Left 993502456 5:88678693-88678715 CCTGGCAGCGACAGACAACTCCC No data
Right 993502467 5:88678734-88678756 GTGGAGAGAGGGTCTGCTGAGGG No data
993502455_993502467 25 Left 993502455 5:88678686-88678708 CCGGTAACCTGGCAGCGACAGAC No data
Right 993502467 5:88678734-88678756 GTGGAGAGAGGGTCTGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993502467 Original CRISPR GTGGAGAGAGGGTCTGCTGA GGG Intergenic
No off target data available for this crispr