ID: 993502936

View in Genome Browser
Species Human (GRCh38)
Location 5:88682302-88682324
Sequence TTTGAAATGCAGTGGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993502936_993502939 2 Left 993502936 5:88682302-88682324 CCTGTTTCCCACTGCATTTCAAA No data
Right 993502939 5:88682327-88682349 CAGCTTTCTCCTTATAAAAATGG No data
993502936_993502941 20 Left 993502936 5:88682302-88682324 CCTGTTTCCCACTGCATTTCAAA No data
Right 993502941 5:88682345-88682367 AATGGAAACATTCATAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993502936 Original CRISPR TTTGAAATGCAGTGGGAAAC AGG (reversed) Intergenic
No off target data available for this crispr