ID: 993505880

View in Genome Browser
Species Human (GRCh38)
Location 5:88708079-88708101
Sequence TGTCTATCACTGATGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993505871_993505880 21 Left 993505871 5:88708035-88708057 CCACCCTAAAGGGAGGGTGCATG No data
Right 993505880 5:88708079-88708101 TGTCTATCACTGATGGAACAGGG No data
993505876_993505880 -10 Left 993505876 5:88708066-88708088 CCTGTATGGGTCCTGTCTATCAC No data
Right 993505880 5:88708079-88708101 TGTCTATCACTGATGGAACAGGG No data
993505873_993505880 17 Left 993505873 5:88708039-88708061 CCTAAAGGGAGGGTGCATGTAGT No data
Right 993505880 5:88708079-88708101 TGTCTATCACTGATGGAACAGGG No data
993505872_993505880 18 Left 993505872 5:88708038-88708060 CCCTAAAGGGAGGGTGCATGTAG No data
Right 993505880 5:88708079-88708101 TGTCTATCACTGATGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993505880 Original CRISPR TGTCTATCACTGATGGAACA GGG Intergenic
No off target data available for this crispr