ID: 993507674

View in Genome Browser
Species Human (GRCh38)
Location 5:88731190-88731212
Sequence ATGTATGGAAAGATGAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 511}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993507672_993507674 25 Left 993507672 5:88731142-88731164 CCTAGGATTTTAATTTGCTTTTG 0: 1
1: 0
2: 1
3: 94
4: 614
Right 993507674 5:88731190-88731212 ATGTATGGAAAGATGAATTGAGG 0: 1
1: 0
2: 1
3: 42
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993507674 Original CRISPR ATGTATGGAAAGATGAATTG AGG Intronic
900821568 1:4893511-4893533 ATGAATGGATAAAGGAATTGTGG + Intergenic
900883527 1:5399461-5399483 ATGTTTGGATAGATGGATGGTGG + Intergenic
900896773 1:5488154-5488176 ATGTGTGGATGGATGAATAGAGG - Intergenic
901006761 1:6175486-6175508 ATGGATGGAAGCATGAATGGTGG + Intronic
902063356 1:13663994-13664016 ATGTATGGAAAGTGGATTAGTGG + Intergenic
902412871 1:16221673-16221695 ATGGATGGATGGATGAATGGGGG + Intergenic
902412887 1:16221773-16221795 ATGAATGGATGGATGAATGGAGG + Intergenic
904917461 1:33980620-33980642 ATGGATGGAAGGATGAATGGAGG - Intronic
906512933 1:46421642-46421664 ATGGATGGGAGGATGAATGGAGG - Intergenic
906813948 1:48858443-48858465 ATGAATGAAAAAATAAATTGTGG + Intronic
907402119 1:54230888-54230910 ATGAATGGATAAATGAAATGTGG - Intronic
907986778 1:59539454-59539476 ATGTATGGACAGTTAATTTGTGG + Intronic
908718412 1:67096037-67096059 AGGCATGGAAAAATGAATAGAGG - Intronic
908810858 1:67980981-67981003 ATGAATGGATAGAGAAATTGTGG + Intergenic
909212527 1:72842765-72842787 ATGAGTGGAAAAATAAATTGTGG + Intergenic
910090447 1:83456735-83456757 ATGAATGGAAGGAAGAATTGAGG - Intergenic
911276865 1:95871247-95871269 ATGAATGGATAAATAAATTGTGG - Intergenic
911970426 1:104428450-104428472 ATGAATGAAAAAATAAATTGTGG + Intergenic
912387662 1:109280286-109280308 TTGTATGGAAAGATGGAGAGAGG - Intronic
912592592 1:110840573-110840595 ATGAATGGATAAATAAATTGTGG + Intergenic
916295910 1:163219803-163219825 ATGTAATGAAAAATAAATTGTGG - Intronic
916322773 1:163523197-163523219 ATGGATGCAAAGAGGAATTCAGG - Intergenic
917990568 1:180373246-180373268 ATGTTTGGAAAGCTGAAATTAGG - Intronic
918305729 1:183244376-183244398 ATGGATGGAAGGATGAATGGAGG - Exonic
918465573 1:184818454-184818476 ATGAATAGACAGATGAATGGTGG + Intronic
918638130 1:186804490-186804512 ATGGATGGATAGATTAATAGGGG - Intergenic
918651478 1:186969334-186969356 ATATGTGGAAAGATCAATTAGGG + Intronic
919226256 1:194707631-194707653 AAGTATGGAAAGACAAACTGAGG - Intergenic
919932920 1:202233274-202233296 ATGTAGGTAAAGATGCATTGAGG + Intronic
919935096 1:202245971-202245993 ATGAATGGATAGATGAAGGGAGG - Intronic
919935125 1:202246062-202246084 ATGAATGGATAGATGAAGGGAGG - Intronic
919935245 1:202246393-202246415 ATGAATGGATAGATGAAGGGAGG - Intronic
920700610 1:208215647-208215669 ATGGATGGAGAGATGCATGGAGG + Intronic
920755561 1:208727747-208727769 ATGGATGGATAGATGGATAGAGG + Intergenic
920978211 1:210805957-210805979 ATGAATGGATAAATGAAATGTGG - Intronic
921222592 1:212983816-212983838 ATGCTTGGAAAGATGCTTTGAGG + Intronic
922711002 1:227832371-227832393 AGGCATGGAAAAATGAATAGAGG - Intronic
922792831 1:228319584-228319606 ATGGATGGATGGATGAATGGTGG - Intronic
922792839 1:228319642-228319664 ATGGATGGATAGATGAATGGTGG - Intronic
922792845 1:228319677-228319699 ATGGATGGATGGATGAATGGTGG - Intronic
924004458 1:239592706-239592728 ATGAATGGATAAATGAAATGTGG - Intronic
924471436 1:244346134-244346156 ATGTAAGGAAACATCCATTGGGG - Intergenic
1063101054 10:2950664-2950686 ATCAATGGAAAGGTGAAATGAGG - Intergenic
1063234248 10:4096357-4096379 ATGGATGGATAAATGAATGGTGG + Intergenic
1063385156 10:5611886-5611908 ATGTCTGCAAGGATGAAATGAGG - Intergenic
1064080463 10:12304035-12304057 ATGTCTGGAAGGAGGTATTGGGG - Intergenic
1064610733 10:17099206-17099228 ATGTATTGATGAATGAATTGGGG + Intronic
1065270364 10:24025577-24025599 ATGAATCTACAGATGAATTGGGG + Intronic
1066046795 10:31602293-31602315 ATGTCTGGGAAGAAGGATTGGGG + Intergenic
1067709642 10:48637677-48637699 ATGGGTGGATGGATGAATTGTGG + Intronic
1067941893 10:50663582-50663604 CTGTATGGATATATGAAGTGGGG + Intergenic
1068382288 10:56272088-56272110 ATTTCTGGAAGCATGAATTGGGG - Intergenic
1068820002 10:61364105-61364127 ATTTAAAGAAAGATGCATTGAGG + Intergenic
1068824427 10:61418490-61418512 CTGTATGAAAAGATAAATTAGGG + Intronic
1068908741 10:62356155-62356177 AATTATGGAATTATGAATTGTGG - Intergenic
1068937773 10:62652783-62652805 ATCTATGGATAGAGGAAGTGGGG - Intronic
1069602788 10:69718925-69718947 ATGAATGGAAATACAAATTGTGG - Intergenic
1070045171 10:72826547-72826569 GTGTAAGGAAATATGAATTCAGG + Intronic
1070863136 10:79688533-79688555 CTGTATGGATATATGAAGTGGGG + Intergenic
1071546496 10:86533958-86533980 ATGCAGGGAAATATGCATTGTGG - Intergenic
1073249372 10:102112489-102112511 AGGGATGGAAAGATAAATGGGGG + Intronic
1073870292 10:107855345-107855367 ATGCATGGGAAGATAAATGGGGG + Intergenic
1074840114 10:117342789-117342811 ATGATTAGAAAGATTAATTGTGG - Intronic
1074896304 10:117780496-117780518 ATGGATGGATAGATGGATGGAGG - Intergenic
1074951936 10:118345491-118345513 ATGTTATGAAAGATTAATTGTGG + Intergenic
1075511766 10:123078111-123078133 ATGAACGGATAGATGAAATGTGG + Intergenic
1075946417 10:126437063-126437085 ATGAATTGAAACATGAATTTGGG - Intronic
1077280511 11:1742933-1742955 ATGGATGGATAGATGGATGGAGG + Intronic
1077280548 11:1743097-1743119 ATGGATGGATAGATGGATGGAGG + Intronic
1078201001 11:9182987-9183009 ATGTATGTAATGATCAAATGGGG - Intronic
1079146690 11:17858518-17858540 ATGTTTGGACTGATGAGTTGGGG - Intronic
1079352618 11:19704710-19704732 ATGTGTGGGAAGAAGAATAGAGG + Intronic
1079913134 11:26335521-26335543 AGGGATGGACATATGAATTGAGG - Intronic
1079962238 11:26939157-26939179 ATATATGCAGAGCTGAATTGTGG + Intergenic
1080761125 11:35249795-35249817 AAGTAGGGAAAGAGTAATTGTGG - Intergenic
1080773932 11:35368176-35368198 ATGAATTGAAAGATGATTTTAGG - Intronic
1082096363 11:48133721-48133743 ATGAATGGATAGATAAAATGTGG + Intronic
1082819147 11:57532212-57532234 GAGAATGGATAGATGAATTGTGG - Intergenic
1083576192 11:63793560-63793582 ATGTGTGCATAGAAGAATTGTGG + Intergenic
1084705135 11:70811707-70811729 ATGGATGGATAAATGAATGGTGG - Intronic
1088792021 11:113234671-113234693 ATGAATGGATACATGAAATGTGG - Intronic
1089367060 11:117927162-117927184 GTGTATGGAAAAAGGAAGTGAGG - Intronic
1089710556 11:120311454-120311476 ATGAATGGAAAGCTGGATGGGGG + Intronic
1089906976 11:122050009-122050031 ATGAATGGACAAATGAAATGTGG - Intergenic
1090123412 11:124057420-124057442 ATGAATGGAAAAACAAATTGTGG - Intergenic
1090289505 11:125529671-125529693 ATGAATAGAGAGATGAAATGTGG - Intergenic
1090410547 11:126506066-126506088 CTGTATGCAAAAATGAATTTAGG + Intronic
1090713924 11:129413455-129413477 TTGGTTGGAAAGGTGAATTGGGG + Intronic
1090738074 11:129629953-129629975 ATGGAAGGAAAGATGGCTTGAGG - Intergenic
1091470974 12:726890-726912 AGGAATGGGAAGATTAATTGTGG + Intergenic
1091668071 12:2433452-2433474 ATGGGTGGATAGATGAATGGAGG - Intronic
1092679728 12:10965710-10965732 AATTATGGAAAGGTGAAATGAGG - Intronic
1092755002 12:11755092-11755114 ATGGATGGATGGATGAATTCAGG + Intronic
1093807563 12:23453062-23453084 ATGAATGGGAATATGAATTGAGG + Intergenic
1093976217 12:25425143-25425165 AAGTATGGAAAGATGAGGCGAGG + Intronic
1095736509 12:45562399-45562421 CTGAATGGATAAATGAATTGTGG - Intergenic
1099044756 12:77703400-77703422 AAGAATGGATAAATGAATTGTGG - Intergenic
1100378032 12:94035609-94035631 ATGAATGGAAAAATAAAATGTGG - Intergenic
1100662468 12:96715018-96715040 ATGGATGGAGAGATGTATTGTGG + Intronic
1101318762 12:103653872-103653894 ATGGATGGAGAGATGCATGGAGG + Intronic
1101981757 12:109413510-109413532 AAGAATGGAAAAATAAATTGGGG + Intronic
1103064166 12:117883056-117883078 ATGGATGGATAGATGAATGGAGG - Intronic
1103424604 12:120821861-120821883 ATGAATGGATAAATAAATTGTGG + Intronic
1104145670 12:126031490-126031512 ATTTATGAAAGGATTAATTGAGG + Intergenic
1104215769 12:126731758-126731780 TTGAGTGGACAGATGAATTGAGG - Intergenic
1104697786 12:130877294-130877316 ATATATGGAAAAATGAAATAAGG + Exonic
1104766135 12:131331374-131331396 ATGGATGGATAGATGAATGGGGG - Intergenic
1104772598 12:131372906-131372928 ATGGATGGAAGGATGGATGGAGG - Intergenic
1105465608 13:20636909-20636931 ATGAATGGATAAATGAAATGTGG + Intronic
1105613439 13:21989556-21989578 TTCTATGGAAAGTTGACTTGGGG + Intergenic
1106233762 13:27843743-27843765 ATGAATAGAAAGATAAAATGTGG + Intergenic
1106649437 13:31673922-31673944 ATAAATGGATAAATGAATTGTGG + Intergenic
1107445693 13:40468559-40468581 ATGGATGGAGAGATGGATGGAGG - Intergenic
1108074114 13:46661027-46661049 ATTTATGTAAAAATGAATGGAGG - Intronic
1108231050 13:48341299-48341321 GTGCATGGAAAAATAAATTGGGG - Intronic
1110060112 13:71030027-71030049 ATTTATGAAAAGATTAATTAAGG - Intergenic
1110398915 13:75066946-75066968 ATAAATGGATCGATGAATTGTGG - Intergenic
1110508505 13:76319998-76320020 ATGAATGGAAAAAGAAATTGTGG - Intergenic
1110710010 13:78640330-78640352 ATGTATGGAAAGATGTATGTAGG - Intronic
1111108309 13:83674450-83674472 AAGTAAGGAAAGAGGAAGTGAGG - Intergenic
1111518398 13:89364872-89364894 ATGTATGAAAAGAAAAACTGAGG - Intergenic
1111781718 13:92736095-92736117 ATGTCTGGATAGATGAGATGGGG - Intronic
1112384531 13:98926373-98926395 ATGAATGGAAAGAAAAACTGAGG - Intronic
1112607753 13:100923912-100923934 ATGTTGGGAATGAGGAATTGGGG - Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112872434 13:103991531-103991553 ATATATGGAATGATGAATTAAGG + Intergenic
1113417571 13:110140284-110140306 ATGTATGGATGGATGGATGGTGG + Intergenic
1113852346 13:113424919-113424941 ATGGATGGATAGATGGATTTTGG - Intronic
1114300716 14:21374700-21374722 ATGAATGGATAGATAAAATGTGG - Intronic
1114435652 14:22705357-22705379 ATGAATGGAAAAATAAAATGTGG + Intergenic
1114579609 14:23745437-23745459 GAGCATGGAAAGATGACTTGGGG + Intergenic
1114809587 14:25881952-25881974 AAGGATGGAAAGGTAAATTGTGG - Intergenic
1115090028 14:29563955-29563977 ATCTATGACAAGAGGAATTGTGG - Intergenic
1115508997 14:34121244-34121266 ATGCATAGAAAGATGACTGGAGG - Intronic
1115908225 14:38225007-38225029 ATGTACAGAAAAATGAAGTGAGG + Intergenic
1116661210 14:47712439-47712461 ATTTTTGGCAAGATGAACTGTGG - Intergenic
1116737565 14:48712175-48712197 CTGTATGAAAAGATGAGATGAGG + Intergenic
1117018885 14:51549199-51549221 ATGGATGGATAGATGGATGGAGG + Intronic
1117122368 14:52581780-52581802 ATTGATGCAAAAATGAATTGTGG - Intronic
1117428966 14:55632591-55632613 AGTTATGGAGAGATGAATGGTGG + Intronic
1118543289 14:66855504-66855526 ATGAACGGATAAATGAATTGTGG - Intronic
1118584159 14:67336296-67336318 AGGAATGGAAAGCTGAACTGTGG - Intronic
1118979708 14:70706627-70706649 ATGAATGAATAAATGAATTGAGG + Intergenic
1119493693 14:75060599-75060621 ATGAATGGATAAATGAAATGTGG + Intronic
1119597830 14:75952624-75952646 ATGAATGGATAAATGAAATGTGG + Intronic
1119716243 14:76861586-76861608 ATCTAAGAAAAGATGAGTTGGGG - Intronic
1120057872 14:79946917-79946939 AAATATGGAAAGATGACTTATGG + Intergenic
1120132745 14:80825719-80825741 CTGTATGAAAAAATGAATTTTGG - Intronic
1120464534 14:84839696-84839718 ATGAATGGATATATCAATTGTGG + Intergenic
1120551199 14:85875319-85875341 ATACATCGAAAGATGAAGTGAGG + Intergenic
1120600417 14:86498127-86498149 ATGAATGGACAAATGAATTATGG + Intergenic
1121032780 14:90673706-90673728 ATGAATGGAAAAACAAATTGTGG + Intronic
1121652131 14:95566470-95566492 ATGTATGTTAAGATGCGTTGGGG - Intergenic
1122600837 14:102920920-102920942 GTGGATGGTAAGATGAATAGTGG - Intergenic
1122958554 14:105083951-105083973 ATGGATGGATGGATGAATAGAGG - Intergenic
1122958572 14:105084031-105084053 AGGAATGGAAAGATGGATAGAGG - Intergenic
1123810785 15:23923668-23923690 ATGTATGTAAAGGTTAATTTGGG + Intergenic
1125838315 15:42773768-42773790 ATGAATGGAAAGAGGAAAGGTGG + Intronic
1128409810 15:67383592-67383614 ATGTTTAGAAAGATGTATTGTGG - Intronic
1128565302 15:68697103-68697125 ATGGATGGATGGATGGATTGTGG + Intronic
1128734126 15:70042729-70042751 ATGGATGGATAGATGAATGGGGG - Intergenic
1129947714 15:79555420-79555442 ATGAATGGATAAATGAAATGTGG - Intergenic
1130145438 15:81270456-81270478 ATGGAGGGAAAGAGGACTTGAGG - Intronic
1131469193 15:92681693-92681715 GTGCATGTAAAGTTGAATTGTGG + Intronic
1131740316 15:95383383-95383405 ATGAATGGAGAGACAAATTGTGG + Intergenic
1131841913 15:96446513-96446535 ATGCATGAGAAGAAGAATTGCGG - Intergenic
1133407001 16:5532599-5532621 ATGGATGAATAAATGAATTGTGG + Intergenic
1133530892 16:6653886-6653908 ATGGATAAAAAGATGAATTTGGG + Intronic
1133862495 16:9609399-9609421 ATGAATGGATGGATGAATTATGG + Intergenic
1134241074 16:12507413-12507435 ATGTATGGAAAACGGAATTGGGG - Intronic
1134893287 16:17860762-17860784 ATGTAAGGAAGAAGGAATTGAGG - Intergenic
1135156502 16:20057569-20057591 ATGGATGGAAGGATGGATGGAGG - Intronic
1135282079 16:21160476-21160498 ATGTATGGAATGATGGAATTGGG + Intronic
1135385068 16:22031731-22031753 ATGAATGGAAAAATAAAATGTGG - Intronic
1135517865 16:23149999-23150021 ATGAATGGAATGATGAATGATGG - Intergenic
1135895786 16:26401035-26401057 ATTTAAAGAAAGATGATTTGGGG + Intergenic
1136279129 16:29197787-29197809 ATGGATGGGTAGATGAATGGAGG + Intergenic
1137640091 16:50021507-50021529 ATTTATGGATAGAGGGATTGGGG - Intergenic
1137936610 16:52640783-52640805 ATTTATGGCAAGAGGAAATGGGG + Intergenic
1138990919 16:62390036-62390058 ATGTATGAAAAAATGAGATGTGG - Intergenic
1139060369 16:63243266-63243288 ATGTATAGAATGATTAATAGTGG + Intergenic
1139928143 16:70503353-70503375 ATGTTTGTAAAGATGTCTTGGGG - Intronic
1140516851 16:75549484-75549506 GTATATGGATAGATAAATTGAGG + Intronic
1141042894 16:80687418-80687440 ATGAATGGATAGATGGATGGTGG + Intronic
1141421614 16:83921375-83921397 ATGGATGGATAGATGGATGGAGG + Exonic
1142152395 16:88518436-88518458 ATGCATGGATAGATGGATGGTGG + Intronic
1142152419 16:88518551-88518573 ATGGATGGAAGGATGGATAGTGG + Intronic
1142152504 16:88518896-88518918 ATGGATGGAAGGATGGATAGTGG + Intronic
1142152628 16:88519429-88519451 ATGGATGGATAGATGCATGGTGG + Intronic
1142960551 17:3549873-3549895 ATGTATGGATGGATGGATGGAGG + Intronic
1143235526 17:5396510-5396532 ATGAATGGATAGATAAAATGTGG - Intronic
1143399073 17:6629474-6629496 ATGCATGGAGACATTAATTGAGG - Intronic
1144657282 17:17044810-17044832 CTGTATTCAAAGTTGAATTGTGG + Intronic
1145261364 17:21356679-21356701 ATGGATGGATGGATGAATGGAGG - Intergenic
1146939193 17:36832296-36832318 ATGGATGGACAGATGGATGGTGG - Intergenic
1147404002 17:40197709-40197731 ATGAATGGACAAATGCATTGGGG + Intergenic
1149032635 17:52101348-52101370 TTGTATGAAAAGATTACTTGAGG + Intronic
1149098008 17:52868540-52868562 AAGTATGTAAAGATTAATAGTGG - Intronic
1149242495 17:54666552-54666574 CTATATGGTAAGATGAAGTGAGG + Intergenic
1149869708 17:60170528-60170550 CTGGATAGAAAGAAGAATTGAGG - Intronic
1151009945 17:70483093-70483115 ATGAATGGATAAATGAAATGTGG + Intergenic
1152031137 17:77844092-77844114 ATGAATGGACAAATGAATTTTGG + Intergenic
1152312479 17:79559536-79559558 ATGGGTGGATAGATGAATGGTGG + Intergenic
1152314051 17:79569798-79569820 GTGTATGAACAGATGAATTATGG + Intergenic
1153526789 18:6003649-6003671 ATCTATTGAAACATGATTTGTGG - Intronic
1155178868 18:23325762-23325784 ATATATAGAAATATGAATTGTGG + Intronic
1155695731 18:28683836-28683858 ATGTACGGGAACATGAACTGAGG + Intergenic
1156022292 18:32613802-32613824 ATGAATGGATAAATGAAATGTGG - Intergenic
1156113465 18:33756952-33756974 ATGGATGGAGAGAATAATTGAGG + Intergenic
1156371181 18:36472789-36472811 ATGAATGGATAGATGCAATGTGG - Intronic
1158061064 18:53342957-53342979 ATGTATATATAGATGTATTGTGG + Intronic
1158735082 18:60070103-60070125 ATATATCAAAAGGTGAATTGTGG + Intergenic
1159113783 18:64090054-64090076 ATGGATGGAAACATGCATTTGGG + Intergenic
1159280971 18:66285064-66285086 TTGTATGGAGACATGAATTTTGG - Intergenic
1159520439 18:69513417-69513439 AAGTATGGCAAGATGTATTAGGG - Intronic
1160139219 18:76305582-76305604 TTGAATGAAAAGATTAATTGGGG + Intergenic
1160315090 18:77836131-77836153 ATGAATAGATGGATGAATTGGGG + Intergenic
1161227341 19:3152981-3153003 ATGGTTGGAAAGATGGAATGGGG + Intronic
1161258527 19:3322943-3322965 ATGGATGGATGGATGAATAGAGG + Intergenic
1161982882 19:7638988-7639010 ATGGATGGACAGATGGATGGAGG - Intronic
1162190692 19:8944094-8944116 ATGGATGGAAAGAAGAAAGGAGG - Intronic
1162217184 19:9146196-9146218 ATGCATGGAAGGTTTAATTGGGG + Intronic
1163238360 19:16043138-16043160 ATGGATGGATGGATGAATGGAGG + Intergenic
1163495165 19:17642280-17642302 ATGTATGGATGGGTGAATTTGGG - Intronic
1163571381 19:18084271-18084293 ATGGATGGATAGATGGATGGGGG - Intronic
1164255807 19:23527219-23527241 ATTTATGAAAGGATTAATTGAGG - Intronic
1164362714 19:27534041-27534063 ATTTCTGGAAAGATGCATTCTGG + Intergenic
1164894316 19:31857798-31857820 ATGAATGGAAAAATAAACTGTGG + Intergenic
1165279288 19:34782919-34782941 ATGTATGGGAAGATGGACTGAGG - Intergenic
1165281709 19:34803532-34803554 ATTTATAGAAAGATGTACTGGGG - Intergenic
1165438599 19:35811054-35811076 ATGGATGGATAGAGGAATAGAGG + Intronic
1166982848 19:46641563-46641585 ATGAATGGACAAATGAAATGTGG + Intergenic
925096363 2:1207554-1207576 AGGGATGCAAAGATGATTTGAGG + Intronic
925250758 2:2435395-2435417 ATTTAATGAAAGATGAGTTGGGG + Intergenic
925502865 2:4526206-4526228 ATGAATGGATAAACGAATTGTGG + Intergenic
925558611 2:5162327-5162349 ATGAATGAATAAATGAATTGTGG + Intergenic
925777025 2:7345806-7345828 ATGGATGGATAGATGAATGGTGG + Intergenic
926892992 2:17654437-17654459 ATTTAGGAAAAGAAGAATTGTGG - Intronic
926906255 2:17808353-17808375 ATGGATGGATGGATGAATAGAGG - Intergenic
926986282 2:18627904-18627926 ATGGATGGATGGATGAATGGCGG - Intergenic
927197154 2:20555883-20555905 ATGTATGCAGAGGTGAAGTGGGG - Intergenic
927431727 2:23031878-23031900 GTGAGTGGAAAGATGAATGGAGG - Intergenic
927848901 2:26486486-26486508 GTGCATGGTTAGATGAATTGGGG + Intronic
928780082 2:34807287-34807309 CTGGATGGAAGGATGACTTGAGG + Intergenic
928912463 2:36436318-36436340 ATTTATTGAAAGGTGAATAGAGG + Intronic
928934472 2:36660887-36660909 ATGGATGGATAAATGAAATGTGG - Intergenic
929052118 2:37846621-37846643 ATGGGTGGAAAGATAAACTGAGG - Intergenic
929067074 2:37988281-37988303 ATCTCTGGAAAGATTTATTGTGG + Intronic
930599801 2:53429888-53429910 ATGTGTGGGAATATAAATTGGGG + Intergenic
931160660 2:59686724-59686746 ATGAATGAACAGATGAATAGAGG - Intergenic
933793354 2:85901390-85901412 ATGTATGTAAAGATGAAATTTGG - Intergenic
934099100 2:88634955-88634977 AAGGATGGAAAGAGGAATTCAGG + Intergenic
934513339 2:94966298-94966320 ATGAATGGATAGATAAAATGTGG - Intergenic
935621095 2:105130281-105130303 ATGTAGGAAAAGATGATGTGTGG - Intergenic
937511840 2:122604265-122604287 ATGTTTGGAAAAATAGATTGGGG + Intergenic
938086560 2:128405826-128405848 ATGTATGCAAGAATGAATTAGGG - Intergenic
939085101 2:137708942-137708964 ATGAGTGGAAAGATGAATAAAGG + Intergenic
939127688 2:138196867-138196889 ATAGATGGATAAATGAATTGTGG - Intergenic
939985329 2:148824655-148824677 ATGGATGGATGGATGAATAGAGG - Intergenic
941581972 2:167309236-167309258 ATGTGAGGAAAGAAAAATTGAGG - Intergenic
942328479 2:174796166-174796188 AGGTATGGAAAGAGGGGTTGGGG + Intergenic
943514963 2:188873899-188873921 ATGTATACATAGATGAAGTGGGG - Intergenic
943659734 2:190546370-190546392 GTGTATGGGAAGATGAATGTAGG + Intergenic
944260447 2:197670264-197670286 AAGAATGGAAAAATAAATTGTGG - Intronic
944372308 2:198999158-198999180 ATTGATGAAAAGAAGAATTGAGG + Intergenic
945005106 2:205396894-205396916 AGATATAGAAAGAGGAATTGAGG - Intronic
945690367 2:213026709-213026731 ATGCATGCAAAGATAAATTTTGG + Intronic
947231943 2:227896857-227896879 AAGAATGGAAAAATGAATTGAGG + Intronic
947247296 2:228063095-228063117 TTATATGGAAAAATGATTTGTGG + Intronic
947466951 2:230359649-230359671 CTGTAGGGAAAGAATAATTGTGG - Intronic
948057113 2:235016797-235016819 GTGAATGAAAAGATGAGTTGAGG - Intronic
948170264 2:235895735-235895757 ATGGATGGATGGATGAATGGAGG + Intronic
1168999705 20:2159497-2159519 ATGCATGGATAAAAGAATTGTGG + Intronic
1169652756 20:7888017-7888039 ATGTATAGAAAGCTGAAAAGAGG - Intronic
1170195752 20:13687583-13687605 ATGAATGGATAAATGAATTGTGG - Intergenic
1170340320 20:15319728-15319750 ATGAATGGAGAAATTAATTGTGG + Intronic
1170493911 20:16906038-16906060 ATGAATGGCAAGATGATTTAAGG + Intergenic
1170502815 20:16992273-16992295 ATGAATGGAAAAATAAAATGTGG - Intergenic
1170814753 20:19704195-19704217 ATGGATGGATAGATGGATGGAGG + Intronic
1171301488 20:24064919-24064941 ATAAATGGAAAGATCAATTTTGG - Intergenic
1172204612 20:33154064-33154086 ATGTGTGGGAAGATGAATGGTGG + Intergenic
1173087697 20:39940065-39940087 ATGGATGGATAGATGGATGGAGG + Intergenic
1173159397 20:40641131-40641153 ATTTATGGCTGGATGAATTGAGG + Intergenic
1173239605 20:41282657-41282679 AGGCATCGAAAGATGAATCGTGG - Intronic
1173435287 20:43026948-43026970 ATGAATGGAAAAAGAAATTGTGG - Intronic
1173465055 20:43274147-43274169 ATGGATGGAAAGATGAGTGGGGG + Intergenic
1174713760 20:52734916-52734938 ATGAATGGATAAATGAATTGTGG - Intergenic
1174748409 20:53087162-53087184 ATGAATGGAGAGAAGAATTGAGG + Intronic
1174758134 20:53180251-53180273 ATGTAATGAAAGATGGATTTTGG - Intronic
1175302408 20:57952291-57952313 ATGGATGGATAGATGAATAATGG - Intergenic
1175526940 20:59641166-59641188 ATGGATGGATAGATGAACAGAGG - Intronic
1175620169 20:60437461-60437483 ATGACTGGAAAGATAAAGTGTGG - Intergenic
1175817281 20:61889855-61889877 ATGGATGGATAGATGGATGGTGG + Intronic
1175817369 20:61890345-61890367 ATGTATGGATAGATGGATAATGG + Intronic
1175984047 20:62755391-62755413 ATGGATGGAATGATGGATGGAGG - Intronic
1176937313 21:14882300-14882322 ATGGATGGAAGGATGGATAGAGG + Intergenic
1177858229 21:26423284-26423306 ACTGATGGAAAGATGAACTGAGG + Intergenic
1178785052 21:35645941-35645963 ATGGATGGATAGACAAATTGTGG - Intronic
1179079094 21:38153698-38153720 AAGGATGGAAATATAAATTGGGG + Intronic
1179343407 21:40533630-40533652 ATGGATGGACAGATGGATGGAGG - Intronic
1179940351 21:44635433-44635455 ATGAATGGATAAATGAAATGTGG + Intronic
1181536744 22:23550218-23550240 ATGAATGGAAAGATGGATGGAGG - Intergenic
1181537065 22:23551876-23551898 ATGGATGAAAAGATGAGTAGAGG - Intergenic
1181565773 22:23736397-23736419 ATGCTTTGACAGATGAATTGAGG + Intergenic
1182072057 22:27470579-27470601 ATGGATGGATGGATAAATTGAGG + Intergenic
1182247650 22:28972487-28972509 ATGAATGGAAACATCAAGTGTGG - Intronic
1183106509 22:35618870-35618892 ATGGATGGATAGATGGATGGAGG - Intronic
1183106541 22:35618998-35619020 ATGGATGGATAGATGGATGGAGG - Intronic
1184293047 22:43508506-43508528 ATGGATGGATAGATGGATGGGGG - Intergenic
1184293351 22:43509509-43509531 ATGGATGGAAGGATGAATGAAGG - Intergenic
1184407933 22:44310752-44310774 AAGCACGGAAAGATGAACTGGGG - Intronic
1185196878 22:49477159-49477181 ATGGATGGATGGATGAATGGTGG + Intronic
1185212921 22:49581940-49581962 ATGGATGGACAGATGAATAATGG - Intronic
949218333 3:1599226-1599248 ATGTATTTGAAAATGAATTGAGG - Intergenic
949274607 3:2263989-2264011 ATGAATGGATAGATAAAATGTGG - Intronic
949875886 3:8625847-8625869 TTGTAGGCAAAGATGAAATGAGG - Intronic
950332535 3:12167968-12167990 ATTTATGGAAGGCTGAATTTAGG + Intronic
952323690 3:32301188-32301210 ATCTGTGGAAAGATGAATGCCGG - Intronic
952573453 3:34745382-34745404 ATGGATGGAAAGATGGATAGTGG + Intergenic
952992018 3:38838556-38838578 GTGAATGGATAAATGAATTGTGG - Intergenic
953502617 3:43452554-43452576 ATGAATGGATAAATGAAATGTGG - Intronic
954091684 3:48289391-48289413 GTGTGTGGAAAGGTGGATTGAGG + Intronic
954318551 3:49814946-49814968 ATGAATGGATAAACGAATTGTGG - Intergenic
954493296 3:50928524-50928546 ATGAATGGAAAAATTAAATGTGG - Intronic
954623675 3:52010403-52010425 ATGGATGGACAGATGGATAGAGG - Intergenic
955489002 3:59463775-59463797 ATGTGTGGAAATATGATTGGAGG - Intergenic
955607785 3:60724356-60724378 ATGAATGGATAAATGAAATGTGG - Intronic
956324641 3:68037968-68037990 ATCTATGGAAAGTTGTCTTGTGG - Intronic
956662105 3:71609186-71609208 ATGTAGTGAAAGAAAAATTGTGG - Intergenic
957215162 3:77311094-77311116 ATGCATGGAAAAATCAATTTTGG + Intronic
957941569 3:87012045-87012067 GTGAATGGAAAAATGAATTGTGG - Intergenic
959654236 3:108782954-108782976 ATGAATGGATAAATCAATTGTGG - Intergenic
959902149 3:111673528-111673550 GTGTATGGAAAGGTGGTTTGGGG + Intergenic
960606567 3:119512069-119512091 ATGTATAAAAAGATTATTTGTGG + Intronic
961434992 3:126910795-126910817 ATCAATGGAAAGATGAGGTGTGG + Intronic
962260697 3:133901800-133901822 GTGTGTGGAAAGATGAAGTAGGG - Intergenic
962777486 3:138676616-138676638 ATGTATGGATAAATAAAATGTGG + Intronic
962912593 3:139867145-139867167 ATGTATGTAAAGATATATTTAGG + Intergenic
962931560 3:140042452-140042474 ATGAATGGAAAAATAAAATGGGG - Intronic
963085476 3:141431572-141431594 TTGTTTGGAAAGATGAAAGGGGG - Intronic
963818605 3:149862652-149862674 ATGAATGAAAAAATAAATTGTGG - Intronic
964316875 3:155454603-155454625 ATTTATGGTAAGGTGTATTGAGG + Intronic
964909263 3:161758138-161758160 ATGTAGGGAAAGAAGATTGGAGG + Intergenic
965167837 3:165219412-165219434 TATTATGGAAAAATGAATTGTGG - Intergenic
965174171 3:165309156-165309178 ATGAATGGATAAATAAATTGTGG - Intergenic
966165085 3:177008029-177008051 ATCTATGTTAAGGTGAATTGTGG + Intergenic
966652810 3:182320501-182320523 AGGAATGGAAAGAAAAATTGAGG + Intergenic
966833863 3:184034214-184034236 ATGAATGGACAGATTAAATGTGG + Intronic
966916902 3:184589640-184589662 ATGAATGGAAGGATGAATAGAGG + Intronic
967954358 3:194866872-194866894 ATTGATGGGAAAATGAATTGCGG + Intergenic
968167404 3:196478425-196478447 ATGTATGGAAAGCAGAAATGAGG - Intronic
968931242 4:3580585-3580607 ATGGATGGATAGATGATTGGAGG - Intronic
969424907 4:7118476-7118498 AGGAATGGAAAGATGGATGGAGG + Intergenic
969424945 4:7118660-7118682 AGGAATGGAAAGATGAATGGTGG + Intergenic
969510739 4:7616392-7616414 ATGGATGGATAGATGGATTATGG - Intronic
969551978 4:7875702-7875724 ATGAATGGATAAATGAAATGTGG + Intronic
970266722 4:14296481-14296503 ATGTCTGGGGAGATGAAGTGTGG + Intergenic
970718103 4:18952014-18952036 ATGTGTAGAAAGATCACTTGGGG + Intergenic
971037756 4:22713646-22713668 ATGGATGGAAAGAAGAGTCGAGG + Intergenic
971560681 4:28076873-28076895 ATGTATGGAATGATGGTGTGAGG + Intergenic
971636585 4:29067951-29067973 ATGTAAGGAATGATGAGTTTAGG + Intergenic
971936598 4:33157325-33157347 ATGAATGGATAAAGGAATTGTGG + Intergenic
972703012 4:41512517-41512539 ATGAATGGATAGATCAAATGTGG + Intronic
972883971 4:43462245-43462267 ATGTGTGTAAAGATGTATAGAGG - Intergenic
973871434 4:55170592-55170614 ATGAATGGAAAAACAAATTGTGG - Intergenic
974379073 4:61114908-61114930 ATTTATGGAAAGAAGAAATATGG - Intergenic
974455357 4:62123568-62123590 ATTTATGGTAGGATGAATAGTGG - Intergenic
975220072 4:71804632-71804654 ATTTATGAAAGGATTAATTGAGG - Intergenic
975220641 4:71809143-71809165 ATTTATGAAAGGATTAATTGAGG - Intergenic
975288823 4:72652233-72652255 ATGAATGGATAGAGGAAATGTGG + Intergenic
975416260 4:74108318-74108340 ATGACTGAAAAGATGAATTTTGG + Intergenic
975530963 4:75399018-75399040 ATGAATGGAAAAATAAAATGTGG + Intergenic
976714241 4:88106381-88106403 ATGAATGGAAAAACGAAATGTGG + Intronic
976831004 4:89313636-89313658 ATGAATGGAAACATAAAATGCGG + Intergenic
977225979 4:94392273-94392295 ATGTTCTGAAAGATGAAATGAGG + Intergenic
978010022 4:103669238-103669260 ATGAATGGAAAGAGAAAATGTGG - Intronic
978682860 4:111403274-111403296 AAGTATGGAAAGAAGAAATGAGG - Intergenic
978738656 4:112113036-112113058 ATGTACTTAAATATGAATTGGGG - Intergenic
978957190 4:114628602-114628624 CTGTCTTGAAAGATGATTTGAGG + Intronic
979142752 4:117199235-117199257 ATGTATAGAAAAAATAATTGAGG + Intergenic
979623679 4:122823897-122823919 ATGAATGGATAAATCAATTGTGG - Intergenic
981143403 4:141297319-141297341 ATGAATGGATGGATGAATGGAGG + Intergenic
981223845 4:142268620-142268642 ATGAATGGAAAAAGGAAATGTGG + Intronic
981796807 4:148605019-148605041 CTTTATGGAAAGAGGAATTCAGG + Intergenic
982950570 4:161690022-161690044 ATAAATGGAAAAAGGAATTGTGG - Intronic
982983094 4:162165864-162165886 ATGTCAGGAAAGATGATCTGTGG + Intergenic
983400973 4:167265204-167265226 GTGAATGGATATATGAATTGTGG - Intergenic
983674082 4:170271454-170271476 ATTTATGGAAACATGAAATAAGG - Intergenic
984033810 4:174639713-174639735 ATGTTTGTAAAGAGGAATGGGGG + Exonic
984422400 4:179541000-179541022 GTGAATGGAAAAATAAATTGTGG - Intergenic
985358810 4:189149613-189149635 TTGTAGGGAAAGATGATTTAGGG - Intergenic
985662963 5:1166447-1166469 ATGGATGGATGGATGAATGGTGG - Intergenic
987877241 5:23693536-23693558 ATGGATGGGAAGATCACTTGTGG + Intergenic
988156080 5:27450588-27450610 ATGAATGGACAAATAAATTGAGG + Intergenic
988919252 5:35925532-35925554 AAGTAGGGAAAGGGGAATTGTGG + Intronic
989362564 5:40620363-40620385 ATTTATTGATAGAAGAATTGAGG - Intergenic
989428632 5:41326167-41326189 ATGCATGGATGGATGAATGGAGG - Intronic
990035856 5:51318845-51318867 ATGAATGGAAACAAGAACTGTGG - Intergenic
990102133 5:52203869-52203891 AAGTATGGTAACAGGAATTGAGG + Intergenic
990323508 5:54651980-54652002 ATATATGGAAAAATCAATTTAGG + Intergenic
990569660 5:57065443-57065465 ATGAATGGAAAAAGAAATTGTGG - Intergenic
990659396 5:57996121-57996143 ATGTATTAAAAGAGGAATAGAGG - Intergenic
991234886 5:64382109-64382131 CTGAATGCAAAAATGAATTGGGG - Intergenic
991548682 5:67812362-67812384 AGGTATGGAGAGAAGAATTCAGG - Intergenic
993355232 5:86898022-86898044 ATGTATGGAAAGTTAAAGAGTGG - Intergenic
993507674 5:88731190-88731212 ATGTATGGAAAGATGAATTGAGG + Intronic
994810341 5:104509706-104509728 ATGAATGGATACATGAAATGTGG - Intergenic
995024682 5:107406238-107406260 ATGTATACAAATATTAATTGTGG + Intronic
995063724 5:107838337-107838359 ATATATGGAGAAATGAATTCAGG - Intergenic
995086255 5:108113481-108113503 ATGGAAGGAAATATGAATGGGGG + Intronic
995463049 5:112422282-112422304 ATGAATGGAAAAACAAATTGTGG - Intergenic
997816561 5:137024874-137024896 ATGAATGGAAAAATAAAATGTGG + Intronic
998522018 5:142809731-142809753 ATGGATGGACAGATGAATGAAGG - Intronic
999388342 5:151171703-151171725 CTGTATGCAGAGATGATTTGGGG + Intergenic
999434630 5:151553671-151553693 ATGTATGTAAAGTTCAATTTAGG - Intronic
1000365121 5:160483483-160483505 ATGAATGGATAAATGAAATGTGG + Intergenic
1001517038 5:172363163-172363185 ATGGATGGACAGATGGATGGAGG - Intronic
1001697415 5:173682011-173682033 ATGAATGGATAAATGAAATGGGG + Intergenic
1002835369 6:861057-861079 TTCTGTGGGAAGATGAATTGGGG + Intergenic
1004670729 6:17794117-17794139 ATGGATGGAAATGTGAACTGGGG + Intronic
1005168033 6:22948505-22948527 ATGTATGGATAAACAAATTGTGG - Intergenic
1005584666 6:27264435-27264457 ATGAATGGAAAAACAAATTGTGG - Intergenic
1006585309 6:35106711-35106733 ACGTATGAAAGGATTAATTGAGG - Intergenic
1007005716 6:38360598-38360620 AAGTATTGAAAGATGAGTGGGGG + Intronic
1007357292 6:41331051-41331073 ATTAATGCATAGATGAATTGAGG + Intergenic
1007630828 6:43272378-43272400 ATGTATGTAATGCTGAAATGAGG - Intronic
1010711428 6:79179700-79179722 ATGAATGGAAATATGAAATGTGG - Intergenic
1012498903 6:99866548-99866570 ATGCTTGGAAAAATGGATTGAGG + Intergenic
1012849635 6:104431335-104431357 ATGTACAGAAAGTGGAATTGAGG - Intergenic
1014314954 6:119852174-119852196 ATGAATGGGCAAATGAATTGGGG - Intergenic
1014617523 6:123621858-123621880 AAGTATGGATAGATGAATATGGG + Intronic
1014710028 6:124795878-124795900 ATGTTTCAAAATATGAATTGGGG + Intronic
1014750823 6:125253985-125254007 ATATATGGATAAAAGAATTGAGG - Intronic
1014863578 6:126500653-126500675 ATATATAGAAATATGAATGGAGG - Intergenic
1015530338 6:134215487-134215509 GTTAATGGAAAGTTGAATTGTGG + Intronic
1015614551 6:135061613-135061635 ATGAATGGAAAAATAAAATGTGG + Intronic
1018425344 6:163674927-163674949 ATGGATGGAAAGATGGCATGGGG + Intergenic
1019327033 7:443570-443592 ATGAATGGATGGATGAATGGTGG + Intergenic
1019824013 7:3268587-3268609 AAGACTGGGAAGATGAATTGGGG - Intergenic
1020011964 7:4810336-4810358 ATGTTTGGAAAGATGATGTGGGG + Intronic
1020565559 7:9790268-9790290 ATGTATGGTGTGATGAATTTGGG - Intergenic
1020573626 7:9897572-9897594 ATGAATGGAAAAAGGAAATGTGG + Intergenic
1020755577 7:12198340-12198362 ATGTAAGAAAATATTAATTGGGG + Intergenic
1021645097 7:22782115-22782137 AAGTCTGGAAAGATGAACTGGGG - Intergenic
1021654170 7:22858587-22858609 ATCTATGGCAAGATGGTTTGGGG + Intergenic
1023083956 7:36551370-36551392 AGGGATGGAAAGATGAAATGAGG - Intronic
1023112824 7:36831308-36831330 AAGTATAGAAAGAAGAATGGAGG - Intergenic
1023721270 7:43097649-43097671 AAGCATGCAAAGATGAATTTTGG - Intergenic
1024968828 7:55050468-55050490 ATGAATGGATAAATGAAATGTGG - Intronic
1025006445 7:55359379-55359401 ATGAATGGAAAAATAAAATGTGG - Intergenic
1026679405 7:72454168-72454190 ATGAATTGAGAGCTGAATTGAGG - Intergenic
1027307299 7:76913194-76913216 ATGAATGGAAGGAAGAATTGAGG - Intergenic
1027477100 7:78646812-78646834 ATGTAGAGAGAGATGAAGTGAGG - Intronic
1027697117 7:81425478-81425500 ATTTATGGAAAGAGACATTGAGG - Intergenic
1027709475 7:81581197-81581219 ATTTCTGTAAAGATGAATTCAGG + Intergenic
1029324418 7:99793793-99793815 ATGGATGGATAAATAAATTGTGG - Intergenic
1030972006 7:116069794-116069816 ATCAGTAGAAAGATGAATTGTGG - Intronic
1031787182 7:126047306-126047328 ATGTATGGATAAAGGAAATGGGG + Intergenic
1031906219 7:127462744-127462766 ATGAATGGATAGACAAATTGTGG + Intergenic
1032381006 7:131480751-131480773 ATGTACTGATACATGAATTGGGG + Intronic
1032417472 7:131747490-131747512 GTATATGGAAAAATGAAGTGGGG + Intergenic
1032535371 7:132658489-132658511 ATTGATGGAAAGATGAATAGAGG - Intronic
1033167619 7:139054380-139054402 ATGCAAGGGAAGAGGAATTGAGG + Intronic
1033639556 7:143248330-143248352 GTGTAGGGAAAGATGAAGGGAGG - Intronic
1033783663 7:144703480-144703502 ATGTATGTCAAGATGTATTCAGG + Intronic
1034834249 7:154337057-154337079 ATGTTTGGAAAGGAGATTTGAGG - Intronic
1034841221 7:154399474-154399496 ATTGTTGGAAAGATGAAATGAGG + Intronic
1035101918 7:156404775-156404797 ATGGGTGAAAAGATAAATTGTGG - Intergenic
1035385100 7:158466550-158466572 ATGAATGGATAGAGCAATTGTGG - Intronic
1035896357 8:3407075-3407097 ATGGAAAGAAAGATGAATGGAGG + Intronic
1036023340 8:4873636-4873658 ATAGATGGAAAGTTGAATGGAGG - Intronic
1036998938 8:13694916-13694938 ATGTATGGACACAAGAAATGGGG - Intergenic
1037049509 8:14352898-14352920 ATGTATGCAGAGATCAATTAGGG - Intronic
1037807078 8:22064162-22064184 ATGGATGGATAGATGAATGCAGG + Intronic
1038087464 8:24215731-24215753 AAGTATGAAAAGATGGATTTAGG + Intergenic
1038222585 8:25624779-25624801 AGAGATGGAAAGATGAATGGAGG - Intergenic
1038461461 8:27720777-27720799 ATGAATGGATGGATGAATAGAGG - Intergenic
1039170273 8:34737488-34737510 ATGTTTGCAAAGATGGATTGAGG - Intergenic
1039694741 8:39898540-39898562 ATGAATGGATAGAAGAAATGTGG - Intergenic
1040681205 8:49812137-49812159 ATGAATGGAAAAAGGAAATGCGG + Intergenic
1041127490 8:54658602-54658624 ATGAATGGATAAATAAATTGTGG - Intergenic
1041391717 8:57353054-57353076 ATGAATGGATACATGAAGTGTGG - Intergenic
1041400486 8:57438060-57438082 ACTTCTGGAAAGATGAAATGAGG - Intergenic
1042494818 8:69444165-69444187 ATGTATGGATAAATAAAATGTGG - Intergenic
1042839982 8:73113865-73113887 ATGGATAGAAAAATGAAATGTGG - Intronic
1042961391 8:74307172-74307194 ATGTAGGTAAAGATGAAGTGAGG - Intronic
1043804840 8:84658796-84658818 ACGTATTGAAAGAGGAATTGGGG + Intronic
1043924387 8:86020755-86020777 ATGTGTGTAAACAGGAATTGGGG - Intronic
1044351452 8:91171147-91171169 ATGTATGAAAAAAAGAATTTGGG + Intronic
1044603757 8:94031583-94031605 AGGTAGGGAAGGATGACTTGAGG - Intergenic
1045199105 8:99960870-99960892 ATTTGTTGAAAGATGACTTGAGG + Intergenic
1045873793 8:106955178-106955200 ATTTATGGAAAGATGCATGGTGG + Intergenic
1046315623 8:112497656-112497678 ATGAATGGACATATAAATTGAGG - Intronic
1046331925 8:112728389-112728411 ATGTATGTAAATATCAATAGAGG + Intronic
1046410689 8:113838626-113838648 ATGAATGGAAAGAATGATTGAGG - Intergenic
1046568942 8:115937922-115937944 TTGTATGGATAGATAAATGGAGG - Intergenic
1046657848 8:116914357-116914379 CTGTATGAAAAGATGAAGAGAGG - Intergenic
1047306844 8:123659401-123659423 ATGGATGGATAGATGGATGGAGG - Intergenic
1047919534 8:129619718-129619740 ATGGATGTAAAGATTAATAGCGG - Intergenic
1047935613 8:129775180-129775202 ATGAATGGAAAAAGAAATTGTGG + Intronic
1048074402 8:131053432-131053454 ATTTATGGAAGGAAGAAATGTGG + Intergenic
1048528273 8:135224678-135224700 ATCAATGGAAAGTTGAATTATGG + Intergenic
1049061602 8:140280307-140280329 CTGTTTAGAAAGATGAATTTTGG - Intronic
1049350653 8:142162773-142162795 ATGGATTGACAGATGAATGGAGG + Intergenic
1049364203 8:142228843-142228865 ATGGGTGGAAGGATGAATGGTGG + Intronic
1049428466 8:142548363-142548385 ATGAATGGATGGATGAATGGGGG + Intergenic
1050780576 9:9329337-9329359 AGTTATGAAAAGATGAAATGGGG - Intronic
1052329990 9:27257757-27257779 ATATTTGGAAAGAAGATTTGTGG - Intergenic
1052617531 9:30860831-30860853 ATGGATGGATAGATGGATGGAGG + Intergenic
1053322313 9:37110338-37110360 ATGTATGGATAAACAAATTGTGG + Intergenic
1056016409 9:82392876-82392898 AGGTAGGGAAAGTTGGATTGAGG - Intergenic
1056019106 9:82423154-82423176 ATTTATGCAAAGAAGGATTGGGG + Intergenic
1056083738 9:83124171-83124193 ATGAATGGAGAAATGAAATGTGG - Intergenic
1056995970 9:91459856-91459878 ATGGATGGATGGATGAATGGGGG + Intergenic
1057461766 9:95269501-95269523 GTGTAAGGAAAGATGATTTATGG + Intronic
1057842578 9:98497996-98498018 ATGAATGGATAAATGAATTGTGG + Intronic
1058456211 9:105140480-105140502 ATGAAAGGAAAGATGAGATGTGG + Intergenic
1060685392 9:125606379-125606401 ATGAATGGGAAGAAGAAATGGGG + Intronic
1060816951 9:126640077-126640099 ATGTATAGAAAGAAGAAGGGAGG + Intronic
1061244930 9:129396683-129396705 ATGGATGAAAAGATGAAGGGTGG + Intergenic
1061245079 9:129397441-129397463 ATAAATGGAAAGATGGATGGAGG + Intergenic
1061963155 9:133998417-133998439 ATGGATGGAAGGATGGGTTGAGG - Intergenic
1061981049 9:134103827-134103849 CTGGATGGATAGATGAATGGTGG - Intergenic
1061981092 9:134104032-134104054 ATGGATGGATGGATGGATTGTGG - Intergenic
1185583286 X:1227041-1227063 ATGAATGGATGGATGGATTGAGG + Intergenic
1185760168 X:2684474-2684496 ATGTGTGGGTGGATGAATTGAGG - Intergenic
1186100674 X:6152922-6152944 ATCTATGTAAAGACAAATTGAGG - Intronic
1186451063 X:9674184-9674206 AAGTATGAAAATATGAATTAAGG + Intronic
1186626595 X:11300197-11300219 ATTTATGGAAAGGTGACTTTGGG + Intronic
1186742260 X:12530843-12530865 ATGGATGAATAGATGAATGGTGG + Intronic
1188442574 X:30227731-30227753 ATGAATGGATAAAGGAATTGTGG - Intergenic
1188626934 X:32297038-32297060 AAGGAGGGAAAGATGAAATGGGG - Intronic
1192334665 X:70207620-70207642 ATGAATGGATAAATGTATTGGGG + Intergenic
1193084869 X:77439955-77439977 AGGCATGGAAAGGTGAAATGGGG - Intergenic
1193225715 X:78980789-78980811 ATTTATAGAAAGATGAACTTTGG - Intergenic
1193484579 X:82071093-82071115 ATGTCTGGACAGATTAACTGTGG - Intergenic
1193728230 X:85068819-85068841 TTGTATGGATAGATGCATTTTGG - Intronic
1193962318 X:87940722-87940744 ATGAATGGAAAAATAAAATGTGG - Intergenic
1194411450 X:93563464-93563486 ATGTATGGATAAATAAAATGTGG + Intergenic
1194419473 X:93655700-93655722 ATGAATGGAAAAATAAAATGTGG + Intergenic
1195137970 X:101930304-101930326 ATGGATGGAAACATGAAATCTGG - Intronic
1195898214 X:109770583-109770605 GTGAATGGATAAATGAATTGTGG + Intergenic
1196531640 X:116794167-116794189 ATGAATGGAAAAATGAATTGTGG - Intergenic
1196657637 X:118235631-118235653 ATGAATGGATAGAGAAATTGTGG + Intergenic
1197169388 X:123414357-123414379 ATGTATGGGATGAGAAATTGTGG - Intronic
1197184215 X:123568708-123568730 ATGAATGGATAGATAAAATGTGG + Intergenic
1197730920 X:129809330-129809352 ATGAATGGATAAATGAAATGTGG + Intronic
1197904498 X:131410575-131410597 ATGTGTGGAAAGAGTAAGTGAGG + Intergenic
1198171148 X:134106309-134106331 ATCTATAGAAAGAGAAATTGAGG - Intergenic
1198326184 X:135575975-135575997 AAGCATAGAAAGATAAATTGAGG - Intronic
1198562122 X:137861994-137862016 AAATATGGAAAAATGAATGGAGG - Intergenic
1199825384 X:151493652-151493674 ATGAATGGATAAATAAATTGTGG - Intergenic
1199902264 X:152187754-152187776 ATGTATGGAAATATCATTGGGGG - Intronic
1200030896 X:153294275-153294297 ATGAATGGATAAACGAATTGTGG - Intergenic
1200742209 Y:6866459-6866481 ATTTATGGAAAGGTGACTTTGGG - Intronic