ID: 993508246

View in Genome Browser
Species Human (GRCh38)
Location 5:88737906-88737928
Sequence AGCTTTATTAAATTTGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 388}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993508245_993508246 0 Left 993508245 5:88737883-88737905 CCTAAGATAGCTTCTTAGTTGTT 0: 1
1: 0
2: 2
3: 40
4: 821
Right 993508246 5:88737906-88737928 AGCTTTATTAAATTTGTGTTAGG 0: 1
1: 0
2: 1
3: 37
4: 388
993508244_993508246 28 Left 993508244 5:88737855-88737877 CCAAATTTTATACTCTAGAAAAT 0: 1
1: 0
2: 4
3: 62
4: 750
Right 993508246 5:88737906-88737928 AGCTTTATTAAATTTGTGTTAGG 0: 1
1: 0
2: 1
3: 37
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993508246 Original CRISPR AGCTTTATTAAATTTGTGTT AGG Intronic
901147678 1:7077668-7077690 AGTTTTATTGGGTTTGTGTTGGG + Intronic
903080801 1:20810586-20810608 AACTTTAATAAATTTGAATTTGG - Intronic
904215865 1:28918371-28918393 AGTTTCATCAAGTTTGTGTTTGG + Intronic
907576081 1:55527019-55527041 AGATTCATTAGATTTGGGTTGGG + Intergenic
909139053 1:71840013-71840035 AGCCTTATTACATTATTGTTTGG - Intronic
909581361 1:77239391-77239413 AGCTTAAAAAAATTTGTTTTAGG - Intergenic
909723530 1:78806247-78806269 AGATTTATTAAAGTTGCATTTGG + Intergenic
909848363 1:80427878-80427900 AATTTTATTAAAGTTGTGATAGG + Intergenic
910050519 1:82968543-82968565 ATCTTTATAAACTTTGTGTCGGG - Intergenic
910104460 1:83616552-83616574 ACATTTATTAAGTTTCTGTTAGG - Intergenic
910174139 1:84410812-84410834 ATCTTTGTTAAATGTGTCTTTGG + Intronic
910269591 1:85379507-85379529 AGCTTTTTGAAATTTGCCTTTGG - Intronic
910417964 1:87021451-87021473 AGCCTTATTTAATTTTTGTTTGG - Intronic
910597892 1:88998957-88998979 TGCTCTATTAAAGTTGTGTTTGG + Intergenic
910700649 1:90070768-90070790 GGCTTTATTACTTTTGAGTTGGG + Intergenic
910756084 1:90692450-90692472 AGCTCTATTATATTTGGCTTTGG - Intergenic
911271367 1:95805747-95805769 AGCTTTACTGAAATTGTTTTAGG - Intergenic
912777454 1:112514738-112514760 AGCTTTATGGAATGTGGGTTAGG + Intronic
912990212 1:114479190-114479212 ACTTTTATTACATTTATGTTGGG - Intronic
913675280 1:121134780-121134802 AGCTTCATTACATTTGTTTTGGG + Intergenic
914027116 1:143922399-143922421 AGCTTCATTACATTTGTTTTGGG + Intergenic
915026760 1:152837898-152837920 ATTTTTATTTAATTTGTCTTAGG + Intergenic
915582257 1:156821366-156821388 AGCTTTAGTAAGTATCTGTTAGG - Intronic
916382432 1:164226882-164226904 AACATTATTTAATGTGTGTTAGG + Intergenic
917428102 1:174936693-174936715 ATCTTGATTAAGTTAGTGTTAGG - Intronic
917961601 1:180149959-180149981 AGCTGCATTAAATGTGTGTGTGG - Intergenic
918706237 1:187665830-187665852 AACTTTTGTATATTTGTGTTAGG + Intergenic
918924869 1:190770168-190770190 AGTGTTATTAAATTTTTTTTTGG - Intergenic
919015007 1:192021278-192021300 AGCTTTGTAAAATTTATGCTGGG - Intergenic
919836373 1:201576572-201576594 AGCTTTATTATTTTTTTTTTTGG - Intergenic
919845093 1:201637120-201637142 TGCTTTATTAGAGTTTTGTTAGG - Intronic
920056834 1:203198961-203198983 AGCTTTATCAAACTTATTTTAGG + Intergenic
920415053 1:205793548-205793570 AGCTTTAGAAAGGTTGTGTTCGG - Intronic
920462641 1:206153617-206153639 AGCTTCATTACATTTGTTTTGGG + Intergenic
921762582 1:218933254-218933276 AGCTTTATTATAGTTGTGAAAGG - Intergenic
921950686 1:220926854-220926876 GGCTTTATTCATTTTGTTTTTGG + Intergenic
923107229 1:230864081-230864103 ATCTTTGTTAGATTTGAGTTTGG - Intronic
923637260 1:235711424-235711446 AGCTTTAAGAAGTTGGTGTTGGG - Intronic
924087216 1:240464839-240464861 AGCTTGATTTTCTTTGTGTTAGG + Intronic
1062794129 10:330117-330139 CTCTTTATTAAATTGCTGTTTGG - Intronic
1065425680 10:25600799-25600821 AGCTTTATAAAATATGCTTTGGG - Exonic
1065998875 10:31085796-31085818 AGCTTTATTAAAATGATGGTTGG + Intergenic
1067010261 10:42704811-42704833 TGCTATATTAAATATTTGTTTGG + Intergenic
1067313501 10:45138765-45138787 TGCTATATTAAATATTTGTTTGG - Intergenic
1068072543 10:52213934-52213956 AGATGTATTAAATGTATGTTTGG - Intronic
1068272750 10:54750856-54750878 TGCTTAATTATATTTGTGTTTGG - Intronic
1069350860 10:67525183-67525205 AGCTTTTTAAAGTTTGAGTTTGG - Intronic
1069462317 10:68607378-68607400 AACTTTATTTAAGTTTTGTTTGG + Intronic
1070821434 10:79357672-79357694 AGCTTTATCAGATTTGTCTCCGG - Intergenic
1071777268 10:88803222-88803244 AAGTTTACTAAATTTGTGTGAGG - Intronic
1072078016 10:91998320-91998342 AGCATTAGTAAATTTTTTTTAGG - Intronic
1073517750 10:104092721-104092743 AGTTCTTTGAAATTTGTGTTAGG + Intergenic
1076043207 10:127269084-127269106 AGCTTTGTAAATTTAGTGTTGGG + Intronic
1078622226 11:12919255-12919277 AGCTATATTAAAGTTGTTTGGGG + Intronic
1079649866 11:22914435-22914457 ATTTTTATTAAATTTTTGTTTGG + Intergenic
1080264830 11:30389596-30389618 AGGATTATTAAATTTGTCATTGG - Intronic
1080837753 11:35956008-35956030 AGGTTGATTAACTTTGAGTTGGG + Intronic
1080980626 11:37400260-37400282 AGCTTGATTAAACTTGTAATAGG + Intergenic
1081190338 11:40096524-40096546 ATTTTTATAAAATGTGTGTTGGG + Intergenic
1081352231 11:42067966-42067988 TGAGTTATTAAATTTTTGTTTGG - Intergenic
1083206990 11:61157638-61157660 AGCTTTAAAAAAATAGTGTTAGG - Intronic
1084728997 11:71061304-71061326 TGCTTTATTAAAATTGGGCTGGG - Intronic
1085928104 11:81046678-81046700 AGCTTTCTTAACTTTCAGTTGGG + Intergenic
1086024643 11:82275741-82275763 AGCTTTAATTAAATTCTGTTTGG + Intergenic
1086155704 11:83663470-83663492 TGGTTTATTAAATATGTATTAGG + Intronic
1086226930 11:84522915-84522937 TGCTTTAGTAAATTCTTGTTTGG + Intronic
1086791734 11:91048378-91048400 AGCTTAATTCACTTTGTCTTTGG - Intergenic
1086817179 11:91386666-91386688 AGATTTAGTAAGTTTGAGTTAGG - Intergenic
1087927838 11:103940919-103940941 AGCTTTATTAAAAATGTCTTTGG - Intronic
1088111890 11:106271390-106271412 AGCTTGATGAAATGTGGGTTTGG + Intergenic
1088120042 11:106357996-106358018 AGTTCTCTAAAATTTGTGTTTGG + Intergenic
1088122351 11:106385281-106385303 TGCTTTATGTAATTTGTGTTAGG + Intergenic
1089015982 11:115165878-115165900 TGCTTCGTTAAATTTTTGTTTGG - Intergenic
1089379685 11:118019163-118019185 AACTTTATGAAAATTATGTTAGG + Intergenic
1089875437 11:121716954-121716976 AGATGTATTAAATTTGTGGATGG - Intergenic
1091024179 11:132127250-132127272 AGCTGTATTCATTTTGGGTTCGG - Intronic
1091073282 11:132589259-132589281 TTCTTTATTAAAGTGGTGTTGGG - Intronic
1092356035 12:7796062-7796084 ATCTTTGTTAAATTTTTGGTTGG + Exonic
1093183495 12:15993740-15993762 AACTTTATAAAATTTTTGCTTGG - Intronic
1093867274 12:24243800-24243822 AACTTTATTGAATTAGTATTGGG - Intergenic
1094038562 12:26097970-26097992 ATTTTCATTAAATTTGTATTTGG - Intergenic
1094253415 12:28393575-28393597 AGCTTTATTTTATCTGTGCTTGG + Intronic
1094701758 12:32877231-32877253 AGCTTGACTAATTTAGTGTTTGG - Intronic
1095108201 12:38260691-38260713 AGTTTTGTTATATTTGTATTAGG + Intergenic
1096821328 12:54237546-54237568 AGCTTTGTTAAGTTTGGTTTGGG - Exonic
1098088673 12:66877398-66877420 AGTGTTATTAAATTTTTGTCAGG + Intergenic
1098444320 12:70550694-70550716 AGCTATAAAAAATTTGTGTCTGG - Intronic
1098903392 12:76135887-76135909 AGCTTTAATAAACTTCTTTTGGG + Intergenic
1099522305 12:83679840-83679862 AGCTTTAATATATCTGTGGTTGG - Intergenic
1099601976 12:84751137-84751159 ACTTTTATTAAATTTTTATTAGG - Intergenic
1099877846 12:88431293-88431315 AGCTTTTTAAAACTTCTGTTTGG + Intergenic
1100589962 12:96017910-96017932 AGTTTTATTAAATATATTTTGGG - Intronic
1101007863 12:100419151-100419173 AGCTAAATTAAAATTGTTTTAGG - Intronic
1101008800 12:100428717-100428739 CGTTTTAATAAATTTGTGTTGGG + Intergenic
1101801619 12:108027473-108027495 ATGCTTATTAAATTTGTTTTAGG - Intergenic
1106050444 13:26185321-26185343 AGCTTTTTAAAATTTCTATTTGG + Intronic
1106323772 13:28667926-28667948 AAGTTTATTCAATTTGTATTGGG - Intronic
1106745934 13:32706806-32706828 AGCTATATCAAATTTGTATTTGG + Intronic
1107223179 13:38011393-38011415 AGTTTTCTTAATATTGTGTTTGG - Intergenic
1107845035 13:44503559-44503581 AGTTTTCTTCAATTTGGGTTGGG + Intronic
1108246691 13:48522701-48522723 AGCCTTATTAAATTGCTTTTTGG - Intronic
1108490726 13:50978553-50978575 AGCTTTAGTAAATGAATGTTGGG + Intergenic
1108740098 13:53328256-53328278 AGCTTTATTAGATTCGATTTTGG + Intergenic
1109105954 13:58251209-58251231 AGCTTTCGTAAATTTGTGGAAGG + Intergenic
1109236022 13:59821622-59821644 AGCTATAATAAGTTTGTTTTTGG - Intronic
1109491450 13:63105633-63105655 AACTTTATTAAAACTGTGATTGG + Intergenic
1109629159 13:65021288-65021310 AGCTTTCTTAATTTTTTCTTAGG + Intergenic
1109849305 13:68039382-68039404 AGCTTTTTTAACTTAGTGCTTGG + Intergenic
1109915337 13:68977906-68977928 AAATTTATTATTTTTGTGTTGGG + Intergenic
1110265601 13:73533748-73533770 AGGGTTACTAAATTTGTGGTAGG - Intergenic
1110601962 13:77385825-77385847 AGCTTTTTCAACTTAGTGTTGGG + Intergenic
1110703261 13:78574521-78574543 ATATTTATTACATTTGTGATTGG + Intergenic
1110886350 13:80641509-80641531 ATCTTTATTATTTTTGTTTTTGG + Intergenic
1111570743 13:90081416-90081438 TGATTTTTTACATTTGTGTTGGG + Intergenic
1112056476 13:95693139-95693161 AGCTATATTATTTATGTGTTCGG + Intronic
1112315394 13:98357818-98357840 AGTTTTATTGAATTTGTTCTGGG + Intronic
1112726973 13:102315804-102315826 AGCTTCAATAAATCTGTGTTAGG - Intronic
1113283717 13:108821365-108821387 AGCTGTGTAAAATTTCTGTTTGG - Intronic
1114158750 14:20138124-20138146 TGCTTTATTAAATTTAAGTTTGG + Intergenic
1115563128 14:34601173-34601195 ATGTTTCTTAAATTTGAGTTTGG - Intronic
1115722235 14:36175721-36175743 AGCTATATTTAACTTGTCTTTGG + Intergenic
1115898696 14:38120007-38120029 TCCTTTATTAAAATTGTTTTCGG + Intergenic
1116510835 14:45744612-45744634 AGCTCTAGAAAATTTGTGTATGG - Intergenic
1117804630 14:59478951-59478973 AAGTTTACAAAATTTGTGTTGGG + Intronic
1118789933 14:69081295-69081317 AGATATATTTAATTTTTGTTTGG + Intronic
1120381130 14:83781139-83781161 AGTTTGTTTAAATTTGTGTCGGG + Intergenic
1120597797 14:86462620-86462642 AGCTTTAATAGAATTGTGTCTGG - Intergenic
1120916917 14:89718601-89718623 AGGTTTTTTAAATTTGTGGAGGG - Intergenic
1121967256 14:98321896-98321918 AGATTTAATAAAATTATGTTTGG + Intergenic
1122368055 14:101208283-101208305 TTCTTTATTGATTTTGTGTTTGG + Intergenic
1122485840 14:102079140-102079162 AGCTATTTTAAATTTTTTTTTGG + Intergenic
1127274403 15:57429582-57429604 AGATTTAATAAATATTTGTTGGG - Intronic
1127702768 15:61517214-61517236 AGCTTTAGTAGAGTTGAGTTTGG - Intergenic
1129018142 15:72487777-72487799 ATGACTATTAAATTTGTGTTTGG - Intronic
1131651764 15:94407389-94407411 TGCTTTATTAAATTTTTACTTGG + Intronic
1134318430 16:13140537-13140559 TGCTATAATAAATCTGTGTTGGG - Intronic
1135907807 16:26529307-26529329 AGGTATCTTAAATTTGTATTTGG - Intergenic
1137961906 16:52889766-52889788 AGCTTTATTTAATTAGTTTAAGG + Intergenic
1138801581 16:60037130-60037152 ATTTTTAATAAATTTGTCTTGGG - Intergenic
1138888510 16:61111418-61111440 AGTTTTATCAAACTTATGTTTGG - Intergenic
1139159238 16:64483374-64483396 AGCACTATTAAATTTCTATTTGG + Intergenic
1139207737 16:65045456-65045478 AGCTTTAGAAAATTTGTGGCAGG - Intronic
1139275623 16:65725038-65725060 AGCTTTACCAACTTTATGTTTGG - Intergenic
1139772810 16:69292817-69292839 AGCTTTATTAAATTACTATCGGG + Intronic
1140444815 16:75017220-75017242 AGCTTTGTTAACTTTCTGTGAGG + Intronic
1143934906 17:10473516-10473538 AGATTAAATATATTTGTGTTGGG + Intergenic
1147436039 17:40416343-40416365 ATCTTTTTTAAATTTTTATTTGG + Intronic
1148519703 17:48261077-48261099 AGAATTATTATAGTTGTGTTTGG + Intronic
1150058752 17:62045349-62045371 AACTTTCTTAAGATTGTGTTTGG - Intronic
1150175609 17:63051791-63051813 AGTTTTAAAAAATTTGTGTTAGG + Intronic
1150843234 17:68628934-68628956 ATGTTTATGAATTTTGTGTTGGG - Intergenic
1151394763 17:73815387-73815409 AATTTTATTATGTTTGTGTTGGG - Intergenic
1152811277 17:82383956-82383978 AGATTTTGTAAATTTGGGTTTGG + Intergenic
1154958469 18:21283550-21283572 AGCTTTTTAAAATTTGTTTTTGG - Intronic
1155876071 18:31090268-31090290 AGCTGTATTAAATTTGTTGGTGG + Intronic
1155892829 18:31288588-31288610 ACCATTATCAAGTTTGTGTTGGG + Intergenic
1156618024 18:38811208-38811230 GGAATTATTATATTTGTGTTAGG - Intergenic
1156991728 18:43417132-43417154 AGCTTTATTAAATATATAATTGG - Intergenic
1157314877 18:46579015-46579037 AGCCTCATTACAGTTGTGTTGGG - Intronic
1158576000 18:58638453-58638475 AGCTTTATTCTATTTGTGATGGG - Intergenic
1159031193 18:63233916-63233938 ATATTTATTAAATCTGAGTTGGG + Intronic
1159224677 18:65517464-65517486 AGCTTTATCAATTTTATTTTGGG + Intergenic
1159475329 18:68913694-68913716 AGCTTTATTGACTTCCTGTTTGG - Intronic
1159634213 18:70785573-70785595 TCCTATAATAAATTTGTGTTTGG + Intergenic
1163531857 19:17854664-17854686 AGCTTTATTATTTTTCTTTTTGG - Intergenic
1168423722 19:56222342-56222364 CGCTTTATTAACTGTGTGTGTGG - Intronic
1168708794 19:58485739-58485761 TGATTTATTAAATTTTTTTTTGG + Intronic
928381223 2:30820563-30820585 AGCTTTATTCACTTCTTGTTTGG + Intergenic
928381268 2:30820990-30821012 TGATTTAGTAAATTTGGGTTGGG + Intergenic
928491099 2:31784140-31784162 AACTTTATTAAATATCTATTGGG - Intergenic
929008336 2:37416856-37416878 AGCTTTATTAGAATTCTATTAGG - Intergenic
929420802 2:41787764-41787786 TGCTTTTTTAGATTTCTGTTTGG - Intergenic
931639752 2:64371383-64371405 AGCTGTTTTATATTTGTGGTAGG + Intergenic
933573096 2:84036409-84036431 ATCTTTATTTACTTTGTGTCAGG + Intergenic
935368786 2:102322948-102322970 GGCTTTATTATTTTTTTGTTTGG + Intronic
936268249 2:111027882-111027904 AGCTTTATTATATATTTCTTAGG + Intronic
936884140 2:117288705-117288727 AGCTTTATTAGATTTATTTCTGG - Intergenic
939092597 2:137796849-137796871 TGCTTAATTAAATGTGTGCTTGG + Intergenic
939225286 2:139356586-139356608 AGGTTTATCTACTTTGTGTTTGG + Intergenic
939240317 2:139550253-139550275 AGCTTTATAAACTTTCTGTGTGG - Intergenic
939320627 2:140615588-140615610 AGCTTTGATAAATTTGTGGTTGG + Intronic
939581098 2:143946836-143946858 ATCTGTATTTAATTTGAGTTGGG + Exonic
940024162 2:149187779-149187801 AAGTTTACAAAATTTGTGTTTGG + Intronic
940158656 2:150687469-150687491 AGCTTAATTAAACTGGTGTTAGG + Intergenic
940388080 2:153097534-153097556 ACCTTTAAGAAATATGTGTTAGG - Intergenic
941097464 2:161255150-161255172 AGCTTTAAAAAAATTGTGGTAGG - Intergenic
941980622 2:171452255-171452277 GAATTTCTTAAATTTGTGTTAGG - Intronic
943116235 2:183674619-183674641 AGTCTTATTCAATCTGTGTTGGG - Intergenic
943199471 2:184801730-184801752 AGCTATTTTAAATTCCTGTTTGG + Intronic
943470681 2:188291473-188291495 AGGTGTTTTAAAATTGTGTTAGG + Intergenic
943538049 2:189177336-189177358 ACCTTTATTAAGCTTGTGATAGG + Intronic
943910347 2:193557814-193557836 ATCTTTCTTAACTTTCTGTTTGG - Intergenic
944091387 2:195915994-195916016 ATGTTTCTTAAATATGTGTTAGG - Intronic
944207628 2:197173019-197173041 AACTTTATTAAACTTGAGTATGG - Intronic
944607093 2:201362085-201362107 CACTATATTAAATTTGAGTTAGG - Intergenic
945327097 2:208494913-208494935 AGCCTTATTGAATTTTTGATGGG - Intronic
945399160 2:209358165-209358187 TTATTTATTTAATTTGTGTTTGG - Intergenic
946501708 2:220255265-220255287 AGCTTTGTTAAATTTTTTTTAGG - Intergenic
946777773 2:223161486-223161508 ATCTTTTTTAAATATGTGTATGG - Intronic
946870600 2:224081016-224081038 TGCTTAATTTAATTTGTATTGGG - Intergenic
947408728 2:229810725-229810747 ATATGTAATAAATTTGTGTTGGG - Intronic
947602126 2:231459603-231459625 AGTTTTAATAATTTGGTGTTAGG - Intronic
948953021 2:241267259-241267281 AAGTTTAAGAAATTTGTGTTGGG + Intronic
1169031481 20:2411676-2411698 ATCTTTTTTAAAATTGTATTGGG + Intronic
1169431807 20:5542961-5542983 AGCTTTATGTTATGTGTGTTAGG - Intergenic
1169954476 20:11085765-11085787 AGGTTTTTTTAATTTGTATTAGG - Intergenic
1169974925 20:11313800-11313822 AGCTATATTAAATTTATTTTAGG + Intergenic
1170236609 20:14112917-14112939 CGATTTATTAACTTTGCGTTGGG + Intronic
1170267794 20:14486942-14486964 TTCTTTTTTAATTTTGTGTTTGG - Intronic
1173321707 20:41993387-41993409 AGCTTAATAAAACTTGTATTGGG + Intergenic
1175429871 20:58892900-58892922 TGGTTTATTAAAATAGTGTTGGG - Intronic
1178560780 21:33637638-33637660 AGTATTATAAAGTTTGTGTTGGG - Intronic
1181367921 22:22393244-22393266 TGTTTTATTAATTTTGTTTTGGG - Intergenic
1182054779 22:27342888-27342910 AGCTTTCTTTAATTAGTGTTAGG + Intergenic
1185198333 22:49486580-49486602 AATATTATTAAATTTGTGCTGGG - Intronic
949175481 3:1057161-1057183 AGCTTTATTAAAACTATCTTTGG + Intergenic
950892576 3:16417394-16417416 AGCATTATTTAATGTGTGTGTGG - Intronic
951552627 3:23889964-23889986 ATCTTTAATAAATTTATATTTGG - Intronic
951955474 3:28248611-28248633 ATCTTTTTTAATTTTTTGTTTGG + Intronic
952779996 3:37087148-37087170 AGCATTATTAAAAGTGTGTGTGG - Intronic
953587635 3:44219012-44219034 AGATTTTTTAAATATGTGTCTGG + Intergenic
955870632 3:63434704-63434726 GGCTTTAAGAAATGTGTGTTAGG + Intronic
957112056 3:75974935-75974957 AGCTTTATTTTATTTTTGTCGGG + Intronic
957713410 3:83893624-83893646 AGCTTTATTTCTTGTGTGTTTGG + Intergenic
958461574 3:94404444-94404466 TGTTTTATTAATTTTGTTTTTGG + Intergenic
962070638 3:132030131-132030153 ATCTTTATTAAGTATGAGTTAGG - Intronic
962247959 3:133813644-133813666 AGCTTTATTATCTTAGTTTTGGG + Intronic
962444908 3:135455571-135455593 TGCATTATTAACTTTGTGGTAGG - Intergenic
962920598 3:139946948-139946970 AGTTTCATTGAATATGTGTTTGG + Intronic
963487786 3:145958053-145958075 ATCTTGAATAAATATGTGTTCGG + Intergenic
964119556 3:153168665-153168687 AGATTTATTAAGATTGTCTTTGG + Intergenic
964397561 3:156261993-156262015 ATCTTTCTTAATTTTGTTTTTGG + Intronic
965356617 3:167682292-167682314 AGGTTTCTCAAATTGGTGTTTGG + Intergenic
968296264 3:197578599-197578621 AGCTCTATTATTTTTGTGTGGGG - Intergenic
968318803 3:197747525-197747547 ATCTTTATTATATTAGTGGTAGG + Intronic
970667652 4:18355854-18355876 TTCTTTATTAATTTTCTGTTTGG + Intergenic
970946222 4:21695489-21695511 AGCTTTATTCAATGCGTATTTGG - Intronic
971010773 4:22431790-22431812 ATCTTTCTTAAATATGTGTATGG + Intronic
971226671 4:24760183-24760205 AGCTGTAAGAATTTTGTGTTTGG + Intergenic
971692063 4:29849566-29849588 AGCTTAATTAAATTTAACTTTGG - Intergenic
972001137 4:34035105-34035127 AGCTTTATAAAAATTGTTCTTGG - Intergenic
972267425 4:37475316-37475338 ACTTTTATTAATTTTGTGCTGGG - Intronic
972498841 4:39658903-39658925 AGATATAAGAAATTTGTGTTAGG + Intergenic
972778490 4:42265478-42265500 AAGTTTATGAATTTTGTGTTGGG + Intergenic
972892823 4:43580383-43580405 TGCTTTCTTAATTTTGTTTTTGG + Intergenic
973797298 4:54440804-54440826 AGCTTTATTGTGTTTGTATTTGG - Intergenic
973963255 4:56133474-56133496 ATGTTTATTAAATATTTGTTGGG - Intergenic
974464459 4:62236714-62236736 AGTTTTAGAAAATTTGTCTTTGG + Intergenic
974488369 4:62532610-62532632 CCCTTTTTTATATTTGTGTTGGG - Intergenic
974506498 4:62780886-62780908 ATCTTTAGTAATTTTGTATTTGG + Intergenic
974681114 4:65163095-65163117 AATATTTTTAAATTTGTGTTTGG - Intergenic
974967991 4:68787433-68787455 AGTTTTATTAAATTTTTGAGAGG - Intergenic
974979007 4:68929837-68929859 AGTTTTATTAAATTTTTGACAGG + Exonic
975003130 4:69250772-69250794 AGTTTTATTAAATTTTTGACAGG - Intergenic
975067355 4:70084009-70084031 AGCTTGATTCTATTTTTGTTTGG + Intergenic
975505892 4:75136974-75136996 AGCTATATTAAAGTTGTTTCAGG - Intergenic
975775364 4:77780729-77780751 GACTTTAATAAATTTGTCTTTGG + Intronic
976019259 4:80600486-80600508 ATCTGTATTATATTTGTATTTGG - Intronic
976190452 4:82481784-82481806 AGTTTTATTAGTTTTATGTTGGG + Intergenic
976398192 4:84580361-84580383 AAATTTATTGTATTTGTGTTTGG - Intergenic
977450230 4:97186702-97186724 ATATTTATCTAATTTGTGTTAGG + Intronic
977548883 4:98419059-98419081 AGCTTTTTTAAGTTTGAGATGGG + Intronic
978512253 4:109533591-109533613 AGGTTTTTTACATTTGGGTTGGG + Exonic
979100304 4:116604222-116604244 AGCTTTTTTTAATCTGGGTTAGG + Intergenic
979129061 4:117016830-117016852 ATCTTTATTAATTTTGGGTTGGG - Intergenic
979477548 4:121175833-121175855 AGTTTTAATTATTTTGTGTTAGG + Intronic
979709432 4:123760864-123760886 AGCATCAGTAAATTTGTGTCAGG + Intergenic
979944205 4:126805597-126805619 AGCTCTAATATATTTGTATTTGG - Intergenic
980028757 4:127799723-127799745 ACCATTATTAACTTTGTGGTTGG + Intronic
981059121 4:140401106-140401128 AGCTTTAAAAAATTTGAGTCAGG - Intronic
981591195 4:146363963-146363985 TCCTCTATTAATTTTGTGTTTGG - Intronic
982016116 4:151155054-151155076 AGCTTTATTGAAATAGTATTGGG - Intronic
982601300 4:157453890-157453912 AGCTTTCTCAATTTTGTGGTTGG + Intergenic
982641121 4:157962704-157962726 AGCTTTATAAAACTTTTATTTGG + Intergenic
983278273 4:165645418-165645440 AAATTTATTAAATTTATGTGTGG + Intergenic
983343629 4:166499430-166499452 ACATTGATTAAATTTGTGTTTGG - Intergenic
983446232 4:167856433-167856455 AGATTTATTAATATAGTGTTTGG - Intergenic
983951341 4:173646360-173646382 TGCTTTAGGAAATTTGTGTTGGG + Intergenic
984163414 4:176281547-176281569 ACCTCTATTAAATATATGTTAGG - Intergenic
984183767 4:176516938-176516960 AGCTTTATTAATTTTCTCTATGG - Intergenic
984411590 4:179404574-179404596 ACCTTTATTGAGTTTGTATTGGG - Intergenic
984467616 4:180120439-180120461 ACCTGTGTAAAATTTGTGTTTGG - Intergenic
984892536 4:184506412-184506434 AGCTTTAATAAAATAGTATTGGG - Intergenic
986545042 5:8887671-8887693 GGTTTTATTAAATTTGTCTCTGG - Intergenic
987527551 5:19072823-19072845 AAATTCATTAAATTTGTCTTAGG - Intergenic
987632461 5:20493046-20493068 AACTTTATGAAATATGTTTTTGG + Intronic
987717490 5:21591284-21591306 ACCTTGATTAAATATGTGTTTGG + Intergenic
987810201 5:22825334-22825356 AGATTTATTAAATGTGGGTTAGG + Intronic
987969089 5:24918932-24918954 AGCTTTTTTAAAAAAGTGTTAGG - Intergenic
988394122 5:30674929-30674951 AGCTACATTAATTTTGTGATAGG + Intergenic
988802155 5:34706592-34706614 AACTTTATTACATTGATGTTGGG + Intronic
989312564 5:40037548-40037570 ACCTATATTATATTTCTGTTGGG - Intergenic
990434789 5:55777998-55778020 AGCTTGATTTAATATTTGTTTGG + Intronic
990963157 5:61416027-61416049 AACCTTCTTACATTTGTGTTGGG + Intronic
991636168 5:68708105-68708127 AGATTTTTTAAAATTGTCTTTGG + Intergenic
991685707 5:69180502-69180524 AACTTTCTTAAATTTATGGTTGG + Intergenic
991725541 5:69532174-69532196 GGCTTTATAGAATTTGTGGTTGG + Intronic
993508246 5:88737906-88737928 AGCTTTATTAAATTTGTGTTAGG + Intronic
994266915 5:97728014-97728036 AGATTTAGAAAATTGGTGTTGGG - Intergenic
995052927 5:107726813-107726835 AGCTTTATCAAACTTGGGTAAGG - Intergenic
995445604 5:112239806-112239828 TCCTTTATAAAGTTTGTGTTAGG - Intronic
996072183 5:119144203-119144225 AGATTTAATAAAGTGGTGTTAGG + Intronic
996303502 5:122017881-122017903 TGCTTTATTAAATGTGTATTGGG + Intronic
996446395 5:123557418-123557440 AAATTTATAACATTTGTGTTGGG + Intronic
997229986 5:132235242-132235264 AGCTTTATTAAACTTTTTATAGG - Intronic
997506701 5:134423374-134423396 AGTTTTCTTAAATTTTTTTTTGG - Intergenic
998238286 5:140419342-140419364 TTCTTTTTTAAATTTGTTTTAGG + Intronic
998614289 5:143722591-143722613 ATCTTAATTAATTTTGTGTAGGG + Intergenic
998699634 5:144683425-144683447 AGCTGTATTCATTATGTGTTGGG + Intergenic
998791413 5:145769575-145769597 TGCTTTAGAAAATTTTTGTTTGG - Intronic
998843544 5:146281581-146281603 AAGTTTATGAAATTTGTGTTGGG + Intronic
999073871 5:148776807-148776829 ATCTTTCTTAAATGTGTGTATGG - Intergenic
999608464 5:153343098-153343120 TGCATTATTAATTTTGTATTTGG - Intergenic
1000146890 5:158462153-158462175 ACCTTCATTAATTTTCTGTTTGG - Intergenic
1000174388 5:158736715-158736737 AGAGTTATTACATATGTGTTAGG + Intronic
1000852955 5:166362644-166362666 TATTTTATTAACTTTGTGTTGGG + Intergenic
1002631909 5:180587856-180587878 TGCTTTAAAGAATTTGTGTTTGG + Intergenic
1005480812 6:26253795-26253817 AGCTGTATTAGCTTTGTGTGAGG - Intergenic
1007460980 6:42018581-42018603 AGCTTTTTCAATTTTGTGTCAGG - Intronic
1008810812 6:55496141-55496163 AACTATATTAAATTTTTTTTCGG + Intronic
1009396950 6:63211292-63211314 AACTTTGTTAACTTTGTGTTTGG - Intergenic
1009625019 6:66127540-66127562 AACTTTTTTAAATTTGAGATTGG + Intergenic
1009997525 6:70912981-70913003 AGGTTTTTTATATTTCTGTTGGG + Intronic
1010645558 6:78384288-78384310 AACTGTATTAAATTTGTCCTCGG - Intergenic
1011763891 6:90597672-90597694 AGTTCTGTTAAATTTCTGTTGGG + Intergenic
1012160519 6:95879568-95879590 ATCTTTATTAAATTAGTAGTAGG + Intergenic
1012305297 6:97648770-97648792 AGTTTTTACAAATTTGTGTTTGG + Intergenic
1012420194 6:99056461-99056483 ACCTTTATTATAGTTGTGGTGGG + Intergenic
1013280524 6:108632240-108632262 AGCTGCCTTAAATTTGTTTTTGG + Intronic
1013513526 6:110865001-110865023 AGCTTTATGGCATTTGTATTCGG - Intronic
1013832320 6:114288943-114288965 TGCTTTATGAACTTTGTATTTGG + Intronic
1014180181 6:118375638-118375660 AGTTTTATTAACTTTGGATTTGG + Intergenic
1014536678 6:122622009-122622031 AGATTTGTTGAATTTGAGTTAGG + Intronic
1014576398 6:123079746-123079768 AGCTTTATTTAAATAGTGTGGGG + Intergenic
1015731933 6:136357825-136357847 AGCTTTATTGAATTTGTGCCAGG - Intronic
1017476960 6:154805950-154805972 AGCTTTATTAGGTATGTGGTAGG + Intronic
1017892478 6:158650640-158650662 AGATTTATTAAATTAGAATTGGG + Intronic
1017982699 6:159415623-159415645 AGCTTTATGAAGTTTCTCTTTGG - Intergenic
1018426172 6:163684253-163684275 AGTTTTAATAGATTTGTATTTGG + Intergenic
1018827641 6:167421670-167421692 GTCTATTTTAAATTTGTGTTAGG + Intergenic
1019404127 7:874442-874464 AGAATTATTTAAGTTGTGTTGGG + Exonic
1020955170 7:14731582-14731604 ATATTTATTAAATTTCTCTTAGG + Intronic
1021763508 7:23924271-23924293 AAATTTACTAAATTTATGTTTGG + Intergenic
1022168327 7:27795918-27795940 AGAATTGTTAAATGTGTGTTTGG - Intronic
1022346494 7:29520339-29520361 AGCTGTATTATATTTGTGAAGGG - Intergenic
1022519316 7:30995593-30995615 AGCTTTAAAAATCTTGTGTTTGG + Intergenic
1025168904 7:56738099-56738121 AACTTTATTTAATTTTTGTTTGG - Intergenic
1025703485 7:63841795-63841817 AACTTTATTTAATTTTTGTTTGG + Intergenic
1026741771 7:72983343-72983365 CTATTTATTTAATTTGTGTTTGG + Intergenic
1027101964 7:75381734-75381756 CTATTTATTTAATTTGTGTTTGG - Intergenic
1027411317 7:77921894-77921916 ACCATTATTAAATTAGTGGTGGG + Intronic
1027630745 7:80602140-80602162 ATCTATATTTAACTTGTGTTAGG + Intronic
1027930633 7:84529681-84529703 ACATATATTAAATGTGTGTTTGG + Intergenic
1027999578 7:85475542-85475564 AGCTATATTATATTTGTGTTTGG + Intergenic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028555775 7:92122916-92122938 AGCTTTATCAGATATGTTTTGGG - Intronic
1028960646 7:96746166-96746188 AGATTTTTAAAAATTGTGTTAGG + Intergenic
1029105738 7:98174137-98174159 ATCTATATTAAATTTCTGTTTGG + Intronic
1030119261 7:106091209-106091231 AGGTGTACTAAAATTGTGTTGGG - Exonic
1031534722 7:122919181-122919203 AGGCTTATTAAATTTGTGAAAGG + Intergenic
1034034718 7:147807011-147807033 AGCCATATATAATTTGTGTTAGG - Intronic
1034704111 7:153124984-153125006 AGCTTTTTGAGATTTGTGTACGG + Intergenic
1035007664 7:155679809-155679831 AGGTGTATTAATTTTTTGTTAGG + Intronic
1035985025 8:4419598-4419620 AGTTTCATTAAATTTTTGGTTGG - Intronic
1036038305 8:5044580-5044602 AATTTTCTTAACTTTGTGTTAGG + Intergenic
1036219027 8:6905172-6905194 TTGTTTTTTAAATTTGTGTTTGG + Intergenic
1036539652 8:9693024-9693046 AGCTTTATTAAATTTCTATCAGG - Intronic
1037001510 8:13724744-13724766 TGCATTTATAAATTTGTGTTTGG - Intergenic
1037028385 8:14069581-14069603 AGCTTTATGACATTTGTCTAGGG + Intergenic
1037343828 8:17876922-17876944 AGCTTTTCTTAAGTTGTGTTTGG - Intronic
1037538139 8:19846464-19846486 TGCTTAATTAAAATTGTGCTGGG + Intronic
1038083714 8:24170558-24170580 AGCTTTACTATATCTCTGTTTGG + Intergenic
1038631867 8:29253171-29253193 ATTTTTTTTAAATTTGTTTTAGG - Intronic
1038883932 8:31641863-31641885 AGTTCTTTTAAATTTGTGTCTGG + Intronic
1038963888 8:32549920-32549942 TGCTTCATGAAATGTGTGTTGGG - Intronic
1041328126 8:56691328-56691350 ATCTTTATCAGATTTGTGTGTGG - Intergenic
1041486248 8:58379970-58379992 ATTTTTATTATATTTGTTTTTGG - Intergenic
1042909329 8:73809298-73809320 ATTTTTATTAAATTAGTATTTGG - Intronic
1043789312 8:84443694-84443716 AGGTTTCTTAAATTTATTTTTGG + Intronic
1044146222 8:88717690-88717712 TGCTTTCTTAATTTTCTGTTTGG - Intergenic
1045991932 8:108317775-108317797 AGTTTTATCAGATTTGTGTTTGG + Intronic
1046988559 8:120420913-120420935 AGCCTTTTTAAATTTGAGTGTGG - Intronic
1047479239 8:125265148-125265170 GGCTTTATTTAATTTTTTTTTGG + Intronic
1047564139 8:126023260-126023282 AGCATGATTAAATATTTGTTGGG - Intergenic
1047669764 8:127132717-127132739 AGCTTCATTATATTGGTTTTAGG + Intergenic
1048108919 8:131444544-131444566 AGCTAAAGTAAATTTGTTTTGGG + Intergenic
1049329117 8:142040537-142040559 AGGTCTATTAAATGTGTTTTTGG + Intergenic
1049956763 9:700307-700329 ACCTGTATCAAATTTGTGTGAGG - Intronic
1050766879 9:9145567-9145589 AGCTTTTTAAAATTCGGGTTGGG - Intronic
1051235656 9:14996014-14996036 AAGTTTATTAATTTTATGTTAGG - Intergenic
1051530167 9:18093514-18093536 AGGTTTATGAAATTTATATTAGG + Intergenic
1051681028 9:19608284-19608306 AGCTTTCATAAATTTTTGTTTGG - Intronic
1051926072 9:22328099-22328121 AGATTTATTCATTTAGTGTTTGG + Intergenic
1052300125 9:26944631-26944653 AAGTTTATGAAATTTGTGTTGGG + Intronic
1052697028 9:31891094-31891116 AGCTTGAGCAAATTTATGTTAGG + Intergenic
1058127689 9:101214380-101214402 AGGTTTATTATATATGTGATAGG + Intronic
1058853131 9:109032747-109032769 AGATTTTTTAAATTTATTTTTGG + Intronic
1059785689 9:117580755-117580777 AGCTTTTTTAAAGGTGTGTGTGG + Intergenic
1060389053 9:123263619-123263641 TGCTTTCTTAATGTTGTGTTTGG - Intronic
1061463984 9:130763385-130763407 AGGTATATTATATTGGTGTTAGG + Intronic
1186270489 X:7881488-7881510 AGATTTTCTAAATTTGTGTGTGG + Intergenic
1186954581 X:14668437-14668459 AGTTTTATTAAAATAGTGTGTGG - Intronic
1187751287 X:22468124-22468146 AGCTTTATTATATTGGTCTGGGG - Intergenic
1188319496 X:28718557-28718579 AGCTTTATTATATATTTCTTTGG + Intronic
1188738543 X:33748211-33748233 GGCTTTCTTATATTTCTGTTGGG + Intergenic
1189864536 X:45311961-45311983 AGCTTTAATCATTTTGTTTTAGG + Intergenic
1189873925 X:45414960-45414982 TGCTTTGTTAATTTTGTGTCTGG + Intergenic
1191057327 X:56255271-56255293 AGCTTTACTGAATTTGTTTATGG + Intronic
1191768093 X:64723262-64723284 AGCTCTAATAATTTTGTGTATGG + Intergenic
1192288105 X:69760264-69760286 GACTTTATTAAATTTTTGGTTGG + Intronic
1192476108 X:71444559-71444581 AAATTTCTAAAATTTGTGTTTGG + Intronic
1192588910 X:72343471-72343493 AGATTTACAAAATTTGAGTTCGG - Intronic
1193675828 X:84451138-84451160 ATTTCTATTAATTTTGTGTTTGG - Intronic
1194178301 X:90680926-90680948 AGCTTTACTAAATTTGAAATAGG + Intergenic
1194566607 X:95496078-95496100 AGTTTTAAAAAATTAGTGTTAGG - Intergenic
1195451395 X:105017392-105017414 AGCTTTAATAAATTTGAACTCGG + Intronic
1196120257 X:112042516-112042538 ACCCTTTTTAAATTTTTGTTAGG + Intronic
1196307133 X:114117009-114117031 AGAATTTTAAAATTTGTGTTTGG + Intergenic
1196362807 X:114886107-114886129 GTCTTTAGTAAATTTTTGTTTGG + Intronic
1196765696 X:119240468-119240490 AGCATTTTTAAAATTGTGTCTGG + Intronic
1197121154 X:122894648-122894670 AATTTTATTAAATTAGTCTTTGG - Intergenic
1199134312 X:144232924-144232946 AGCTCTGGTAAATTTGTGCTGGG + Intergenic
1199351546 X:146808254-146808276 AATTTTATTAAATTTATTTTTGG - Intergenic
1199352361 X:146816239-146816261 AATTTTATTAAATTTATTTTTGG + Intergenic
1200524962 Y:4263091-4263113 AGCTTTACTAAATTTGAAATAGG + Intergenic
1201757857 Y:17506877-17506899 AGATTTATCAAGTTTGTGATAGG + Intergenic
1201843697 Y:18399105-18399127 AGATTTATCAAGTTTGTGATAGG - Intergenic