ID: 993508743

View in Genome Browser
Species Human (GRCh38)
Location 5:88745230-88745252
Sequence TAGGACGCTCAGCTCTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993508743_993508748 30 Left 993508743 5:88745230-88745252 CCTCCACAGAGCTGAGCGTCCTA 0: 1
1: 0
2: 1
3: 10
4: 112
Right 993508748 5:88745283-88745305 TGCAATGAGAAATGTAATGTTGG 0: 1
1: 0
2: 1
3: 18
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993508743 Original CRISPR TAGGACGCTCAGCTCTGTGG AGG (reversed) Intronic