ID: 993509815

View in Genome Browser
Species Human (GRCh38)
Location 5:88757580-88757602
Sequence CTGTAGTTAATTAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993509815_993509822 20 Left 993509815 5:88757580-88757602 CCCCCTTCCCTAATTAACTACAG 0: 1
1: 0
2: 1
3: 12
4: 164
Right 993509822 5:88757623-88757645 AAAAACAAAATAGCCAGGCATGG 0: 8
1: 409
2: 5015
3: 19193
4: 76981
993509815_993509821 15 Left 993509815 5:88757580-88757602 CCCCCTTCCCTAATTAACTACAG 0: 1
1: 0
2: 1
3: 12
4: 164
Right 993509821 5:88757618-88757640 CATTAAAAAACAAAATAGCCAGG 0: 1
1: 3
2: 63
3: 563
4: 5747
993509815_993509823 23 Left 993509815 5:88757580-88757602 CCCCCTTCCCTAATTAACTACAG 0: 1
1: 0
2: 1
3: 12
4: 164
Right 993509823 5:88757626-88757648 AACAAAATAGCCAGGCATGGAGG 0: 11
1: 829
2: 18393
3: 78839
4: 153506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993509815 Original CRISPR CTGTAGTTAATTAGGGAAGG GGG (reversed) Intronic
901845805 1:11981202-11981224 ATGTAGTTAAAAAAGGAAGGAGG + Intronic
901845805 1:11981202-11981224 ATGTAGTTAAAAAAGGAAGGAGG + Intronic
906637818 1:47421381-47421403 CTGTAGGGAAGCAGGGAAGGTGG + Intergenic
906637818 1:47421381-47421403 CTGTAGGGAAGCAGGGAAGGTGG + Intergenic
906664060 1:47605541-47605563 CAATAGTTAATTAGGGAAGTTGG + Intergenic
906664060 1:47605541-47605563 CAATAGTTAATTAGGGAAGTTGG + Intergenic
909063176 1:70902727-70902749 GTGTAGTTGGTTAGGGCAGGAGG + Intronic
909063176 1:70902727-70902749 GTGTAGTTGGTTAGGGCAGGAGG + Intronic
910675814 1:89815572-89815594 TTTTATTTAAATAGGGAAGGGGG + Intronic
910675814 1:89815572-89815594 TTTTATTTAAATAGGGAAGGGGG + Intronic
911234246 1:95393418-95393440 CAGTAGTTACTTAGGGATCGGGG - Intergenic
911234246 1:95393418-95393440 CAGTAGTTACTTAGGGATCGGGG - Intergenic
915277183 1:154797257-154797279 CTGTAGATAATCAAGGATGGTGG + Intronic
915277183 1:154797257-154797279 CTGTAGATAATCAAGGATGGTGG + Intronic
917807160 1:178624343-178624365 CTGCTGTTAATTATGGAACGGGG - Intergenic
917807160 1:178624343-178624365 CTGCTGTTAATTATGGAACGGGG - Intergenic
918496799 1:185148817-185148839 CATTAGTTATTTAGGGAAAGGGG - Intronic
918496799 1:185148817-185148839 CATTAGTTATTTAGGGAAAGGGG - Intronic
918898494 1:190380247-190380269 ATGTGGTTAATGAGGGAAAGTGG + Intronic
918898494 1:190380247-190380269 ATGTGGTTAATGAGGGAAAGTGG + Intronic
920639149 1:207734506-207734528 GGGTAGTTAATTAGGAAAAGAGG + Intronic
920639149 1:207734506-207734528 GGGTAGTTAATTAGGAAAAGAGG + Intronic
921848481 1:219908472-219908494 CTGAAGTTAAATATGTAAGGAGG + Intronic
921848481 1:219908472-219908494 CTGAAGTTAAATATGTAAGGAGG + Intronic
923897023 1:238282248-238282270 TTGTAGGCAATTAGGGAGGGTGG + Intergenic
923897023 1:238282248-238282270 TTGTAGGCAATTAGGGAGGGTGG + Intergenic
1063801697 10:9586916-9586938 AAATAGCTAATTAGGGAAGGAGG - Intergenic
1063801697 10:9586916-9586938 AAATAGCTAATTAGGGAAGGAGG - Intergenic
1066052537 10:31648794-31648816 GTCTATTTCATTAGGGAAGGTGG + Intergenic
1066052537 10:31648794-31648816 GTCTATTTCATTAGGGAAGGTGG + Intergenic
1066134670 10:32433072-32433094 CTGTATTTTAGTAGGGATGGTGG - Intergenic
1066134670 10:32433072-32433094 CTGTATTTTAGTAGGGATGGTGG - Intergenic
1068942016 10:62689583-62689605 AACTAGTTAACTAGGGAAGGGGG + Intergenic
1068942016 10:62689583-62689605 AACTAGTTAACTAGGGAAGGGGG + Intergenic
1069734187 10:70641441-70641463 GGGTATTTAATTAGGAAAGGAGG - Intergenic
1069734187 10:70641441-70641463 GGGTATTTAATTAGGAAAGGAGG - Intergenic
1071141263 10:82511754-82511776 CTGTAGTGAACAAGGGAAAGGGG + Intronic
1071141263 10:82511754-82511776 CTGTAGTGAACAAGGGAAAGGGG + Intronic
1071820912 10:89279757-89279779 CTGTACTTAAGTAAGGAAGTGGG + Intronic
1071820912 10:89279757-89279779 CTGTACTTAAGTAAGGAAGTGGG + Intronic
1073243625 10:102074339-102074361 CTGGAGAAAAGTAGGGAAGGTGG + Intergenic
1073243625 10:102074339-102074361 CTGGAGAAAAGTAGGGAAGGTGG + Intergenic
1074002242 10:109385040-109385062 CGATGGTTAATTAGGGAAGAGGG + Intergenic
1074002242 10:109385040-109385062 CGATGGTTAATTAGGGAAGAGGG + Intergenic
1076524435 10:131102611-131102633 CCAGAGTTAATTAGGGGAGGAGG - Intronic
1076524435 10:131102611-131102633 CCAGAGTTAATTAGGGGAGGAGG - Intronic
1079860650 11:25666877-25666899 CTGTCATTAATAAGAGAAGGGGG + Intergenic
1079860650 11:25666877-25666899 CTGTCATTAATAAGAGAAGGGGG + Intergenic
1081026452 11:38020278-38020300 CTGTAGTCATTTAGGAAAGCAGG - Intergenic
1081026452 11:38020278-38020300 CTGTAGTCATTTAGGAAAGCAGG - Intergenic
1081158526 11:39724844-39724866 AAGGAGTTGATTAGGGAAGGAGG - Intergenic
1081158526 11:39724844-39724866 AAGGAGTTGATTAGGGAAGGAGG - Intergenic
1085705579 11:78784365-78784387 CTGTAGGATATAAGGGAAGGGGG - Intronic
1085705579 11:78784365-78784387 CTGTAGGATATAAGGGAAGGGGG - Intronic
1086115035 11:83240406-83240428 CTGTAGGTAATCAAGGAGGGTGG + Intronic
1086115035 11:83240406-83240428 CTGTAGGTAATCAAGGAGGGTGG + Intronic
1086500373 11:87446779-87446801 ATGCAGTTAACTAGAGAAGGGGG - Intergenic
1086500373 11:87446779-87446801 ATGCAGTTAACTAGAGAAGGGGG - Intergenic
1087985891 11:104679019-104679041 ATGTAGTTAATTAGTGGGGGAGG - Intergenic
1087985891 11:104679019-104679041 ATGTAGTTAATTAGTGGGGGAGG - Intergenic
1089889626 11:121867989-121868011 CACTAGTTCATTAGAGAAGGTGG - Intergenic
1089889626 11:121867989-121868011 CACTAGTTCATTAGAGAAGGTGG - Intergenic
1090560561 11:127927677-127927699 CTATAGTTAGTCAGGGAGGGAGG + Intergenic
1090560561 11:127927677-127927699 CTATAGTTAGTCAGGGAGGGAGG + Intergenic
1091206806 11:133827134-133827156 CTGTAGGTATCTGGGGAAGGGGG - Intergenic
1091206806 11:133827134-133827156 CTGTAGGTATCTGGGGAAGGGGG - Intergenic
1091893782 12:4083985-4084007 CTGGAGTTATTAAGGAAAGGGGG - Intergenic
1091893782 12:4083985-4084007 CTGGAGTTATTAAGGAAAGGGGG - Intergenic
1093756499 12:22858929-22858951 CTGTAGCTAACCAGGGAAGGAGG + Intergenic
1093756499 12:22858929-22858951 CTGTAGCTAACCAGGGAAGGAGG + Intergenic
1094206161 12:27843189-27843211 CTGTGGTTAATTCTGGATGGTGG - Intergenic
1094206161 12:27843189-27843211 CTGTGGTTAATTCTGGATGGTGG - Intergenic
1095834427 12:46621659-46621681 CTGTATTCAATTAGGAAAAGAGG + Intergenic
1095834427 12:46621659-46621681 CTGTATTCAATTAGGAAAAGAGG + Intergenic
1097155524 12:57009289-57009311 CCCTACTTAATTAGAGAAGGAGG - Intergenic
1097155524 12:57009289-57009311 CCCTACTTAATTAGAGAAGGAGG - Intergenic
1098653739 12:73004936-73004958 CTGTAGCTAATAAGGGAACTGGG + Intergenic
1098653739 12:73004936-73004958 CTGTAGCTAATAAGGGAACTGGG + Intergenic
1099280134 12:80633419-80633441 CTGTAAATAATAAGGGAAGTAGG - Intronic
1099280134 12:80633419-80633441 CTGTAAATAATAAGGGAAGTAGG - Intronic
1100348044 12:93751975-93751997 CTGTAGTTACTTAAGGGTGGAGG + Intronic
1100348044 12:93751975-93751997 CTGTAGTTACTTAAGGGTGGAGG + Intronic
1100530191 12:95455335-95455357 CTGTAGTCACTCAAGGAAGGCGG + Intergenic
1100530191 12:95455335-95455357 CTGTAGTCACTCAAGGAAGGCGG + Intergenic
1100765346 12:97858396-97858418 CTGTAGTTCATTAGGGATATTGG - Intergenic
1100765346 12:97858396-97858418 CTGTAGTTCATTAGGGATATTGG - Intergenic
1101815808 12:108145217-108145239 CTGCAGTTAATTAGGTGAAGAGG - Intronic
1101815808 12:108145217-108145239 CTGCAGTTAATTAGGTGAAGAGG - Intronic
1105254458 13:18732977-18732999 CTGTGGTTAATTTGTGGAGGAGG - Intergenic
1105254458 13:18732977-18732999 CTGTGGTTAATTTGTGGAGGAGG - Intergenic
1109480258 13:62943949-62943971 ATATAGTTAATTAGAGAAGGTGG - Intergenic
1109480258 13:62943949-62943971 ATATAGTTAATTAGAGAAGGTGG - Intergenic
1117138383 14:52761534-52761556 CTGGTGTTAATTAGGGTAGGAGG - Intronic
1117138383 14:52761534-52761556 CTGGTGTTAATTAGGGTAGGAGG - Intronic
1118949567 14:70422293-70422315 ATGTAATGAATGAGGGAAGGGGG - Intergenic
1118949567 14:70422293-70422315 ATGTAATGAATGAGGGAAGGGGG - Intergenic
1120874918 14:89367156-89367178 CTGTTGAAAATTAGGGAAGATGG - Intronic
1120874918 14:89367156-89367178 CTGTTGAAAATTAGGGAAGATGG - Intronic
1121863930 14:97344783-97344805 CTCGAGTAAATTAAGGAAGGCGG - Intergenic
1121863930 14:97344783-97344805 CTCGAGTAAATTAAGGAAGGCGG - Intergenic
1121874729 14:97440828-97440850 CTGTATTGTATCAGGGAAGGAGG + Intergenic
1121874729 14:97440828-97440850 CTGTATTGTATCAGGGAAGGAGG + Intergenic
1121984580 14:98491926-98491948 CTGTAGAAAATTAGGAAAAGTGG - Intergenic
1121984580 14:98491926-98491948 CTGTAGAAAATTAGGAAAAGTGG - Intergenic
1125001158 15:34771231-34771253 CTGTAGTTATTTTAGGAAGATGG - Intergenic
1125001158 15:34771231-34771253 CTGTAGTTATTTTAGGAAGATGG - Intergenic
1125462348 15:39919682-39919704 GTGTAGTTAAGCAGGGACGGTGG - Intronic
1125462348 15:39919682-39919704 GTGTAGTTAAGCAGGGACGGTGG - Intronic
1126743088 15:51798107-51798129 CTGTATTTAATTTGGGAGTGAGG + Intronic
1126743088 15:51798107-51798129 CTGTATTTAATTTGGGAGTGAGG + Intronic
1127124419 15:55798305-55798327 CTGTTGTTGCTTAGGGAAAGAGG - Intergenic
1127124419 15:55798305-55798327 CTGTTGTTGCTTAGGGAAAGAGG - Intergenic
1128395226 15:67218185-67218207 CTGTTTTTAATTAGTGAAAGAGG - Intronic
1128395226 15:67218185-67218207 CTGTTTTTAATTAGTGAAAGAGG - Intronic
1129580479 15:76803740-76803762 AGGTAGTTAAGTTGGGAAGGTGG - Intronic
1129580479 15:76803740-76803762 AGGTAGTTAAGTTGGGAAGGTGG - Intronic
1130197619 15:81795434-81795456 CTATGGTTTATTAAGGAAGGAGG + Intergenic
1130197619 15:81795434-81795456 CTATGGTTTATTAAGGAAGGAGG + Intergenic
1133472730 16:6091342-6091364 CTGCATTTACATAGGGAAGGGGG - Intronic
1133472730 16:6091342-6091364 CTGCATTTACATAGGGAAGGGGG - Intronic
1133691274 16:8217839-8217861 CTTTAGGTAAGTAGGGAAGGTGG + Intergenic
1133691274 16:8217839-8217861 CTTTAGGTAAGTAGGGAAGGTGG + Intergenic
1133734852 16:8607272-8607294 ATGTAGCTCATTAGGGAAAGGGG + Intergenic
1133734852 16:8607272-8607294 ATGTAGCTCATTAGGGAAAGGGG + Intergenic
1140054832 16:71516529-71516551 CTTTAATGTATTAGGGAAGGAGG - Intronic
1140054832 16:71516529-71516551 CTTTAATGTATTAGGGAAGGAGG - Intronic
1140451261 16:75072549-75072571 CTGCAGTTAATTGGAGAAAGTGG + Intronic
1140451261 16:75072549-75072571 CTGCAGTTAATTGGAGAAAGTGG + Intronic
1140807053 16:78542269-78542291 CTGTAGATACTTGGGTAAGGAGG + Intronic
1140807053 16:78542269-78542291 CTGTAGATACTTGGGTAAGGAGG + Intronic
1146783347 17:35696107-35696129 ATGAAGTTAATGAGGAAAGGAGG - Intronic
1146783347 17:35696107-35696129 ATGAAGTTAATGAGGAAAGGAGG - Intronic
1152261866 17:79271718-79271740 CTGTCTTTAATTAGGCAACGGGG - Intronic
1152261866 17:79271718-79271740 CTGTCTTTAATTAGGCAACGGGG - Intronic
1152346058 17:79752577-79752599 CTGGAATTAATCAGGGAAGTGGG + Intergenic
1152346058 17:79752577-79752599 CTGGAATTAATCAGGGAAGTGGG + Intergenic
1153371097 18:4316978-4317000 GTGTAGGTCATGAGGGAAGGAGG - Intronic
1153371097 18:4316978-4317000 GTGTAGGTCATGAGGGAAGGAGG - Intronic
1155149672 18:23112968-23112990 CTGAAGTTCCTTAGGGAATGGGG + Intergenic
1155149672 18:23112968-23112990 CTGAAGTTCCTTAGGGAATGGGG + Intergenic
1156569547 18:38237914-38237936 CTATCTTTAATTAGGGAATGAGG + Intergenic
1156569547 18:38237914-38237936 CTATCTTTAATTAGGGAATGAGG + Intergenic
1158896219 18:61916161-61916183 CTTTAGTTTACTAGGGAAGAAGG - Intergenic
1158896219 18:61916161-61916183 CTTTAGTTTACTAGGGAAGAAGG - Intergenic
1161665551 19:5574056-5574078 CTGTAGGCAAATAGGGAAGGAGG - Intergenic
1161665551 19:5574056-5574078 CTGTAGGCAAATAGGGAAGGAGG - Intergenic
1161939068 19:7391336-7391358 CTCCAGGTAATTAGAGAAGGTGG + Intronic
1161939068 19:7391336-7391358 CTCCAGGTAATTAGAGAAGGTGG + Intronic
1164487528 19:28672433-28672455 TTGTAGTTATTTAAGGCAGGAGG - Intergenic
1164487528 19:28672433-28672455 TTGTAGTTATTTAAGGCAGGAGG - Intergenic
1165279379 19:34783453-34783475 CTGGAGTGATTTAGGGCAGGGGG + Intergenic
1165279379 19:34783453-34783475 CTGGAGTGATTTAGGGCAGGGGG + Intergenic
1166105837 19:40597641-40597663 CTCTAGTTTATTGGGGCAGGGGG + Intronic
1166105837 19:40597641-40597663 CTCTAGTTTATTGGGGCAGGGGG + Intronic
925896350 2:8475134-8475156 CTGAGGCTAATTAGGGCAGGGGG - Intergenic
925896350 2:8475134-8475156 CTGAGGCTAATTAGGGCAGGGGG - Intergenic
926333533 2:11846252-11846274 CTGTATTCAATTAGGAAAAGAGG - Intergenic
926333533 2:11846252-11846274 CTGTATTCAATTAGGAAAAGAGG - Intergenic
928486961 2:31742121-31742143 CGGTATTCAATTAGGGAAAGGGG - Intergenic
928486961 2:31742121-31742143 CGGTATTCAATTAGGGAAAGGGG - Intergenic
930863253 2:56096722-56096744 GGGTAGTTAATTAGGAAAAGAGG + Intergenic
930863253 2:56096722-56096744 GGGTAGTTAATTAGGAAAAGAGG + Intergenic
931771857 2:65504148-65504170 CTGTAGTCAAAAAGGGTAGGAGG + Intergenic
931771857 2:65504148-65504170 CTGTAGTCAAAAAGGGTAGGAGG + Intergenic
935831529 2:107005699-107005721 CTGAAGCTAAGGAGGGAAGGAGG - Intergenic
935831529 2:107005699-107005721 CTGAAGCTAAGGAGGGAAGGAGG - Intergenic
940027870 2:149227548-149227570 ATGTAGTTAATTTGGGATAGTGG + Intergenic
940027870 2:149227548-149227570 ATGTAGTTAATTTGGGATAGTGG + Intergenic
941886765 2:170536081-170536103 CTGCAGTAAAGTAGTGAAGGAGG + Intronic
941886765 2:170536081-170536103 CTGCAGTAAAGTAGTGAAGGAGG + Intronic
943016558 2:182517573-182517595 CTGTGGTTGAATAGGGAAGGTGG + Intronic
943016558 2:182517573-182517595 CTGTGGTTGAATAGGGAAGGTGG + Intronic
946950568 2:224870296-224870318 CTGTAATTTATAAAGGAAGGAGG - Intronic
946950568 2:224870296-224870318 CTGTAATTTATAAAGGAAGGAGG - Intronic
947308818 2:228777903-228777925 ATGAAATTAATCAGGGAAGGAGG + Intergenic
947308818 2:228777903-228777925 ATGAAATTAATCAGGGAAGGAGG + Intergenic
947424110 2:229967341-229967363 GTGTATTCAATTAGGGAAAGAGG - Intronic
947424110 2:229967341-229967363 GTGTATTCAATTAGGGAAAGAGG - Intronic
1170471087 20:16669030-16669052 CTGTGGCGAATTAGGGAAGGTGG + Intergenic
1170471087 20:16669030-16669052 CTGTGGCGAATTAGGGAAGGTGG + Intergenic
1176943868 21:14955414-14955436 CAATAGTGAATTAGGGAGGGAGG + Intergenic
1176943868 21:14955414-14955436 CAATAGTGAATTAGGGAGGGAGG + Intergenic
1176944027 21:14956840-14956862 CAATAGTGAATTAGGGAGGGAGG + Intergenic
1176944027 21:14956840-14956862 CAATAGTGAATTAGGGAGGGAGG + Intergenic
1179401791 21:41091070-41091092 CTGTGGTTCATGAGGGAAGCGGG - Intergenic
1179401791 21:41091070-41091092 CTGTGGTTCATGAGGGAAGCGGG - Intergenic
1182819874 22:33206440-33206462 CTGTAGGTAAGTAAGGCAGGAGG - Intronic
1182819874 22:33206440-33206462 CTGTAGGTAAGTAAGGCAGGAGG - Intronic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
1184521596 22:44997795-44997817 CTGTAGTCAATTTGGGGAGAGGG - Intronic
1184521596 22:44997795-44997817 CTGTAGTCAATTTGGGGAGAGGG - Intronic
952401236 3:32966043-32966065 CTGTAGTGCAGAAGGGAAGGTGG + Intergenic
952401236 3:32966043-32966065 CTGTAGTGCAGAAGGGAAGGTGG + Intergenic
953281356 3:41560827-41560849 GGGTATTTAATTAGGAAAGGAGG - Intronic
953281356 3:41560827-41560849 GGGTATTTAATTAGGAAAGGAGG - Intronic
956093923 3:65696174-65696196 CTGCAGAAAGTTAGGGAAGGGGG - Intronic
956093923 3:65696174-65696196 CTGCAGAAAGTTAGGGAAGGGGG - Intronic
956266726 3:67404735-67404757 CAGTAGTTAATTATAGAAGTTGG - Intronic
956266726 3:67404735-67404757 CAGTAGTTAATTATAGAAGTTGG - Intronic
959767733 3:110052905-110052927 GTCTAGTAAATTAGAGAAGGTGG - Intergenic
959767733 3:110052905-110052927 GTCTAGTAAATTAGAGAAGGTGG - Intergenic
961125716 3:124415947-124415969 CTGTACCTTATTAGGGAAGTAGG + Intronic
961125716 3:124415947-124415969 CTGTACCTTATTAGGGAAGTAGG + Intronic
961870190 3:129981925-129981947 ATGTGGGTAATAAGGGAAGGAGG - Intergenic
961870190 3:129981925-129981947 ATGTGGGTAATAAGGGAAGGAGG - Intergenic
964185420 3:153937036-153937058 CTGGAGTTAATCAAGGAAGATGG - Intergenic
964185420 3:153937036-153937058 CTGGAGTTAATCAAGGAAGATGG - Intergenic
966557201 3:181276030-181276052 ATATAGTTCATAAGGGAAGGAGG - Intergenic
966557201 3:181276030-181276052 ATATAGTTCATAAGGGAAGGAGG - Intergenic
967289360 3:187904074-187904096 TTGTAGATAATTAGAGTAGGAGG - Intergenic
967289360 3:187904074-187904096 TTGTAGATAATTAGAGTAGGAGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969367379 4:6705089-6705111 CTCTAGCTAATTTGTGAAGGAGG + Intergenic
969367379 4:6705089-6705111 CTCTAGCTAATTTGTGAAGGAGG + Intergenic
971071717 4:23101740-23101762 CTGAAGTTAAATATGTAAGGAGG - Intergenic
971071717 4:23101740-23101762 CTGAAGTTAAATATGTAAGGAGG - Intergenic
975246249 4:72123941-72123963 GTGTATTCAATTAGGAAAGGAGG + Intronic
975246249 4:72123941-72123963 GTGTATTCAATTAGGAAAGGAGG + Intronic
975247776 4:72140221-72140243 GTGTATTCAATTAGGAAAGGAGG - Intronic
975247776 4:72140221-72140243 GTGTATTCAATTAGGAAAGGAGG - Intronic
975963941 4:79946467-79946489 CTATTCTTAATTAGGGCAGGAGG + Intronic
975963941 4:79946467-79946489 CTATTCTTAATTAGGGCAGGAGG + Intronic
976376605 4:84352742-84352764 TTTTAGTGAATTAGGGAAGAGGG + Intergenic
976376605 4:84352742-84352764 TTTTAGTGAATTAGGGAAGAGGG + Intergenic
977041091 4:92020035-92020057 CTGTTCTTAAATAGGGAAGAAGG - Intergenic
977041091 4:92020035-92020057 CTGTTCTTAAATAGGGAAGAAGG - Intergenic
980881481 4:138714245-138714267 CTCCAGTTAATTAGGGTAGAGGG + Intergenic
980881481 4:138714245-138714267 CTCCAGTTAATTAGGGTAGAGGG + Intergenic
981764250 4:148229854-148229876 CTAGAGTTCTTTAGGGAAGGGGG - Intronic
981764250 4:148229854-148229876 CTAGAGTTCTTTAGGGAAGGGGG - Intronic
982573858 4:157083419-157083441 ATGTAATTGATTAGGGAGGGAGG + Intronic
982573858 4:157083419-157083441 ATGTAATTGATTAGGGAGGGAGG + Intronic
982914348 4:161186854-161186876 ATGAAGTTAATTAGGAAAAGAGG + Intergenic
982914348 4:161186854-161186876 ATGAAGTTAATTAGGAAAAGAGG + Intergenic
983445606 4:167846599-167846621 CTGTAGTTCATGAAGCAAGGAGG - Intergenic
983445606 4:167846599-167846621 CTGTAGTTCATGAAGCAAGGAGG - Intergenic
986644800 5:9906444-9906466 CAACAGTTATTTAGGGAAGGGGG + Intergenic
986644800 5:9906444-9906466 CAACAGTTATTTAGGGAAGGGGG + Intergenic
991614946 5:68486389-68486411 CTGTAGTAAAAAGGGGAAGGAGG - Intergenic
991614946 5:68486389-68486411 CTGTAGTAAAAAGGGGAAGGAGG - Intergenic
992779504 5:80115050-80115072 CTGTCTTTGATTAGGGAAAGTGG + Intronic
992779504 5:80115050-80115072 CTGTCTTTGATTAGGGAAAGTGG + Intronic
993509815 5:88757580-88757602 CTGTAGTTAATTAGGGAAGGGGG - Intronic
993509815 5:88757580-88757602 CTGTAGTTAATTAGGGAAGGGGG - Intronic
994407341 5:99361217-99361239 CTATAATTTCTTAGGGAAGGAGG + Intergenic
994407341 5:99361217-99361239 CTATAATTTCTTAGGGAAGGAGG + Intergenic
995210356 5:109530652-109530674 CTGTTGTCAGTCAGGGAAGGGGG + Intergenic
995210356 5:109530652-109530674 CTGTTGTCAGTCAGGGAAGGGGG + Intergenic
995854613 5:116578102-116578124 ATGTAGTTAACAAGGGCAGGGGG - Intergenic
995854613 5:116578102-116578124 ATGTAGTTAACAAGGGCAGGGGG - Intergenic
997093802 5:130887706-130887728 CTGTGGTTAATTAAGAAAGGCGG - Intergenic
997093802 5:130887706-130887728 CTGTGGTTAATTAAGAAAGGCGG - Intergenic
997374287 5:133385692-133385714 CTGTAATTAAAAAAGGAAGGAGG - Intronic
997374287 5:133385692-133385714 CTGTAATTAAAAAAGGAAGGAGG - Intronic
1000372922 5:160554516-160554538 CTTTAGTGATGTAGGGAAGGAGG + Intergenic
1000372922 5:160554516-160554538 CTTTAGTGATGTAGGGAAGGAGG + Intergenic
1002304559 5:178275502-178275524 ATAAAGTTAATTAGGGAAGAAGG + Intronic
1002304559 5:178275502-178275524 ATAAAGTTAATTAGGGAAGAAGG + Intronic
1003005784 6:2380332-2380354 CTGCAGTTTAATAGGGAAGATGG - Intergenic
1003005784 6:2380332-2380354 CTGCAGTTTAATAGGGAAGATGG - Intergenic
1003770264 6:9291353-9291375 CTGAATTTATTGAGGGAAGGGGG - Intergenic
1003770264 6:9291353-9291375 CTGAATTTATTGAGGGAAGGGGG - Intergenic
1003905360 6:10694485-10694507 CTGTCGTTAATAGGGTAAGGAGG - Exonic
1003905360 6:10694485-10694507 CTGTCGTTAATAGGGTAAGGAGG - Exonic
1004763539 6:18698220-18698242 CTATAGATAATAAGGGCAGGGGG + Intergenic
1004763539 6:18698220-18698242 CTATAGATAATAAGGGCAGGGGG + Intergenic
1005664295 6:28035082-28035104 CTGTGGTCAATTTGGAAAGGAGG - Intergenic
1005664295 6:28035082-28035104 CTGTGGTCAATTTGGAAAGGAGG - Intergenic
1007730114 6:43940461-43940483 CTGAAGTTAACCAGGGAGGGAGG + Intergenic
1007730114 6:43940461-43940483 CTGAAGTTAACCAGGGAGGGAGG + Intergenic
1008097278 6:47351680-47351702 CTGTAGTTAAATAAGGCATGGGG - Intergenic
1008097278 6:47351680-47351702 CTGTAGTTAAATAAGGCATGGGG - Intergenic
1008674719 6:53807277-53807299 GTGGAGTGAATGAGGGAAGGAGG - Intronic
1008674719 6:53807277-53807299 GTGGAGTGAATGAGGGAAGGAGG - Intronic
1011645428 6:89453128-89453150 CTGTAGTTACTTTTGGAAGAAGG - Intronic
1011645428 6:89453128-89453150 CTGTAGTTACTTTTGGAAGAAGG - Intronic
1012396785 6:98807220-98807242 CTATAGTTAATTAGCGAAACTGG - Intergenic
1012396785 6:98807220-98807242 CTATAGTTAATTAGCGAAACTGG - Intergenic
1012811161 6:103960234-103960256 ATGCAGTTAAATAGGCAAGGAGG + Intergenic
1012811161 6:103960234-103960256 ATGCAGTTAAATAGGCAAGGAGG + Intergenic
1012920308 6:105215721-105215743 CAGTAATTAACTAGGGATGGTGG + Intergenic
1012920308 6:105215721-105215743 CAGTAATTAACTAGGGATGGTGG + Intergenic
1013898290 6:115120781-115120803 ATGTAGGTAATTGGGGAAGGGGG - Intergenic
1013898290 6:115120781-115120803 ATGTAGGTAATTGGGGAAGGGGG - Intergenic
1015485939 6:133769656-133769678 CTGTGGTTTGTTAAGGAAGGGGG - Intergenic
1015485939 6:133769656-133769678 CTGTGGTTTGTTAAGGAAGGGGG - Intergenic
1016777277 6:147918523-147918545 GTGTATTTAATTAGGAAAAGAGG + Intergenic
1016777277 6:147918523-147918545 GTGTATTTAATTAGGAAAAGAGG + Intergenic
1023738481 7:43255893-43255915 TTGTAGTTAATTAGGTGAGAAGG + Intronic
1023738481 7:43255893-43255915 TTGTAGTTAATTAGGTGAGAAGG + Intronic
1025479527 7:60964632-60964654 CTGTATTCAATTAGGAAAAGAGG + Intergenic
1025479527 7:60964632-60964654 CTGTATTCAATTAGGAAAAGAGG + Intergenic
1026287017 7:68972210-68972232 CTGTTGTAAATAAGGGAGGGAGG - Intergenic
1026287017 7:68972210-68972232 CTGTTGTAAATAAGGGAGGGAGG - Intergenic
1030202847 7:106922979-106923001 CTGTATTCAATTAGGAAAAGAGG + Intergenic
1030202847 7:106922979-106923001 CTGTATTCAATTAGGAAAAGAGG + Intergenic
1030627952 7:111864416-111864438 CTGTACCTAGTCAGGGAAGGAGG + Intronic
1030627952 7:111864416-111864438 CTGTACCTAGTCAGGGAAGGAGG + Intronic
1031777425 7:125920350-125920372 CTGTAGCTAATAAGGGAACTGGG - Intergenic
1031777425 7:125920350-125920372 CTGTAGCTAATAAGGGAACTGGG - Intergenic
1032005531 7:128299337-128299359 CTGGAGTGATTTAGGGCAGGGGG + Exonic
1032005531 7:128299337-128299359 CTGGAGTGATTTAGGGCAGGGGG + Exonic
1034885135 7:154793521-154793543 CTCTAGCTAATTAGGGAAATTGG - Intronic
1034885135 7:154793521-154793543 CTCTAGCTAATTAGGGAAATTGG - Intronic
1037182561 8:16025066-16025088 CTGTATGCAATGAGGGAAGGTGG + Intergenic
1037182561 8:16025066-16025088 CTGTATGCAATGAGGGAAGGTGG + Intergenic
1050589950 9:7150413-7150435 CTGTAGGTAGTTAGGCAAAGAGG - Intergenic
1050589950 9:7150413-7150435 CTGTAGGTAGTTAGGCAAAGAGG - Intergenic
1052888357 9:33671506-33671528 GTGTACTTAATTAGGAAAAGAGG + Intergenic
1052888357 9:33671506-33671528 GTGTACTTAATTAGGAAAAGAGG + Intergenic
1055439919 9:76327405-76327427 CTGTATTTAACTAGAGACGGGGG - Intronic
1055439919 9:76327405-76327427 CTGTATTTAACTAGAGACGGGGG - Intronic
1057078692 9:92155674-92155696 CCAGAGTTAATTAGGGGAGGAGG - Intergenic
1057078692 9:92155674-92155696 CCAGAGTTAATTAGGGGAGGAGG - Intergenic
1057940885 9:99282675-99282697 CTGTAATTAATTAGAGAATTTGG - Intergenic
1057940885 9:99282675-99282697 CTGTAATTAATTAGAGAATTTGG - Intergenic
1059904683 9:118969582-118969604 TTATAGTTAATTAGGGAATCTGG - Intergenic
1059904683 9:118969582-118969604 TTATAGTTAATTAGGGAATCTGG - Intergenic
1059938185 9:119332726-119332748 CTGCAGTTCAGTGGGGAAGGGGG - Intronic
1059938185 9:119332726-119332748 CTGCAGTTCAGTGGGGAAGGGGG - Intronic
1185721119 X:2382244-2382266 CTGTTGTTAGCTATGGAAGGAGG + Intronic
1185721119 X:2382244-2382266 CTGTTGTTAGCTATGGAAGGAGG + Intronic
1186801926 X:13101609-13101631 CTGTAGTTACTTAGGGGAGGGGG + Intergenic
1186801926 X:13101609-13101631 CTGTAGTTACTTAGGGGAGGGGG + Intergenic
1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG + Intronic
1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG + Intronic
1188761134 X:34031406-34031428 CTGTAGTTTAATAGAGGAGGTGG - Intergenic
1188761134 X:34031406-34031428 CTGTAGTTTAATAGAGGAGGTGG - Intergenic
1189884349 X:45525642-45525664 TTGTAGCTAATGAGGGATGGTGG + Intergenic
1189884349 X:45525642-45525664 TTGTAGCTAATGAGGGATGGTGG + Intergenic
1190259968 X:48791464-48791486 CTGCACTTAACTAGGGAAAGTGG - Intronic
1190259968 X:48791464-48791486 CTGCACTTAACTAGGGAAAGTGG - Intronic
1190544764 X:51514284-51514306 GTGTATTTAATTAGGAAAAGAGG - Intergenic
1190544764 X:51514284-51514306 GTGTATTTAATTAGGAAAAGAGG - Intergenic
1191042849 X:56103675-56103697 GTGTATTCAATTAGGGAAAGAGG - Intergenic
1191042849 X:56103675-56103697 GTGTATTCAATTAGGGAAAGAGG - Intergenic
1191992894 X:67058328-67058350 GTGTATTTAATTAGGAAAAGAGG + Intergenic
1191992894 X:67058328-67058350 GTGTATTTAATTAGGAAAAGAGG + Intergenic
1193004360 X:76599051-76599073 ATGTATTTAATTAGGAAAAGAGG - Intergenic
1193004360 X:76599051-76599073 ATGTATTTAATTAGGAAAAGAGG - Intergenic
1194913610 X:99677595-99677617 ATGTAGTTAGTTATGGAAGGGGG - Intergenic
1194913610 X:99677595-99677617 ATGTAGTTAGTTATGGAAGGGGG - Intergenic
1197040910 X:121933919-121933941 CTGTAATTTATAAGGGAAAGAGG + Intergenic
1197040910 X:121933919-121933941 CTGTAATTTATAAGGGAAAGAGG + Intergenic
1199565460 X:149211156-149211178 CTGTGTTTAGTTAGGGAAGGGGG - Intergenic
1199565460 X:149211156-149211178 CTGTGTTTAGTTAGGGAAGGGGG - Intergenic
1201791392 Y:17844775-17844797 CTGTAGCTAATAAGAGAATGTGG + Intergenic
1201791392 Y:17844775-17844797 CTGTAGCTAATAAGAGAATGTGG + Intergenic
1201810162 Y:18061214-18061236 CTGTAGCTAATAAGAGAATGTGG - Intergenic
1201810162 Y:18061214-18061236 CTGTAGCTAATAAGAGAATGTGG - Intergenic
1202353005 Y:24014420-24014442 CTGTAGCTAATAAGAGAATGTGG + Intergenic
1202353005 Y:24014420-24014442 CTGTAGCTAATAAGAGAATGTGG + Intergenic
1202517774 Y:25655695-25655717 CTGTAGCTAATAAGAGAATGTGG - Intergenic
1202517774 Y:25655695-25655717 CTGTAGCTAATAAGAGAATGTGG - Intergenic