ID: 993515130

View in Genome Browser
Species Human (GRCh38)
Location 5:88822854-88822876
Sequence CAACCATCTCATATGGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993515130_993515136 7 Left 993515130 5:88822854-88822876 CCATGATCCATATGAGATGGTTG 0: 1
1: 0
2: 0
3: 4
4: 108
Right 993515136 5:88822884-88822906 GCAGTACTATAATTTCTCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993515130 Original CRISPR CAACCATCTCATATGGATCA TGG (reversed) Intronic
900080552 1:853855-853877 CAGTCATCTCATGTTGATCAGGG - Intergenic
901076332 1:6557116-6557138 CAACCATCTCGTGTGCTTCATGG - Intronic
905333919 1:37230707-37230729 AAACCAACTCAAATGGATTAAGG - Intergenic
911406504 1:97447081-97447103 CAGCCATCTCCTCTGGTTCATGG + Intronic
911499412 1:98666726-98666748 CCACCATATCCTATAGATCAAGG - Intronic
913018182 1:114760592-114760614 AAACCATCTCCTATGCAACAGGG + Intergenic
916555851 1:165893587-165893609 TAACCATCTCATTTGGCTTATGG - Intronic
919371755 1:196737492-196737514 CAACCACCTCAGATAGAACACGG + Exonic
920857192 1:209672891-209672913 CAACCATCTTATTTTGCTCAGGG - Intergenic
923191134 1:231621930-231621952 CAAGCATCTCATAGGGAGCCTGG + Intronic
924188551 1:241522809-241522831 CAACCATCTCAGATGGAAGCAGG + Intergenic
1065644356 10:27818983-27819005 CAACCTTCTCATATGTGTAAAGG + Intronic
1066012161 10:31204864-31204886 AAAGCATCTCACATGGTTCATGG + Intergenic
1069637969 10:69937171-69937193 GAACCATTTCAAATGGATGAGGG + Intronic
1072774678 10:98178991-98179013 CAATCATGTCATCTGCATCAGGG + Intronic
1078759577 11:14241634-14241656 CAGTCATCTCATATGCCTCATGG - Intronic
1079039431 11:17048406-17048428 CATCCATCACATAGAGATCACGG - Intergenic
1080840037 11:35975743-35975765 CAACCTTCTCTCATGAATCACGG - Intronic
1081061185 11:38479736-38479758 CAACCATCACAAAAGGATAAGGG + Intergenic
1081123180 11:39291326-39291348 AAACCATATCAGATGGATAAAGG - Intergenic
1081446369 11:43134911-43134933 CAATCATTTCATCTGGGTCAGGG + Intergenic
1086562540 11:88184700-88184722 CAACCAGGTCATATGCATGAAGG + Intergenic
1095687829 12:45055426-45055448 AAATCACCTCAAATGGATCAGGG + Intergenic
1097694659 12:62764735-62764757 CCACCTTCACAGATGGATCACGG - Intronic
1100146412 12:91682889-91682911 CAACCATCTGATATTCAACAAGG - Intergenic
1100791732 12:98137563-98137585 AAACCATCTGGTATGGTTCAAGG + Intergenic
1102485524 12:113252767-113252789 CAATCTGCTCATGTGGATCAGGG - Intronic
1102622997 12:114211577-114211599 CAAGCATCCCATATGGTTCTTGG - Intergenic
1106245689 13:27947974-27947996 CAACCATCTCATTATGTTCATGG - Intergenic
1107405656 13:40110370-40110392 CAAGCATTGCATTTGGATCAGGG + Intergenic
1109910811 13:68907736-68907758 CTACCAGTTCATTTGGATCAGGG + Intergenic
1110540508 13:76701893-76701915 CACCCATCCCCTATTGATCAAGG + Intergenic
1115088329 14:29543910-29543932 CCACAATCTCATTAGGATCATGG + Intergenic
1115451598 14:33554102-33554124 CAGGCTTCTCATATGGCTCAAGG + Intronic
1116119962 14:40710520-40710542 CAACCATCTGATCTGCAACAAGG + Intergenic
1116375460 14:44193640-44193662 CATCCATCTCATATCGTTCTGGG - Intergenic
1121636669 14:95458370-95458392 TAACCATACCATATGGATGAGGG - Intronic
1122181803 14:99960581-99960603 CAACCATCAGATTTGGATTACGG + Intergenic
1123189929 14:106559296-106559318 CCAGCATCTCATATGGAGGAGGG + Intergenic
1129568604 15:76653563-76653585 CAACCATCTCATCTTCAACAAGG + Intronic
1131784374 15:95896064-95896086 CAACAATCTCACGTGGGTCAAGG + Intergenic
1138073009 16:54011826-54011848 TCACCATCTTATATGGATGAGGG - Intronic
1139014924 16:62678216-62678238 CAACCATGTCATGTGGAAGATGG - Intergenic
1139103165 16:63793727-63793749 CTACCATCTAAAATGGACCAAGG - Intergenic
1139124937 16:64066596-64066618 CAACCCTCTCATAGAGATCATGG - Intergenic
1140649284 16:77069048-77069070 ACATCATCTCTTATGGATCATGG - Intergenic
1144097641 17:11916271-11916293 CAAACAACCCATATAGATCAGGG - Intronic
1144711940 17:17406953-17406975 CAACCACCGCATCTGGCTCATGG + Intergenic
1159440549 18:68474094-68474116 CAACCTTCTAAGATTGATCAAGG + Intergenic
1164576388 19:29407770-29407792 CAACCCTCTCATCTGACTCAGGG + Intergenic
1165857794 19:38890252-38890274 CAAGCATCTCAGATGCATGACGG + Intronic
1168174111 19:54610463-54610485 CAACCATCTGATATTTAACAAGG + Intronic
925403952 2:3593465-3593487 CAACCATGTCATCTGCAACAAGG + Intergenic
926281683 2:11453581-11453603 CATCCATCTAATATGGTTCTTGG + Exonic
927366065 2:22297940-22297962 CAACCATTATATGTGGATCAAGG - Intergenic
936893373 2:117398165-117398187 CAACCATCTTATATTCAACAAGG + Intergenic
937536054 2:122888658-122888680 GAACACTTTCATATGGATCAGGG - Intergenic
942139462 2:172963384-172963406 CAAAGATCTCATATGGTTAAAGG + Intronic
943588519 2:189768848-189768870 AAACCATATCATATGGAAAATGG + Intergenic
945239844 2:207666434-207666456 CAACTTTCTCATCTAGATCAAGG - Intergenic
947351898 2:229255129-229255151 CATCCAACTCAGATGGATGATGG + Intronic
1169558689 20:6775590-6775612 CAACAATTTCATGTGGTTCAAGG - Intronic
1171308291 20:24124666-24124688 CAAACTTCTCATATGGAACATGG - Intergenic
950962671 3:17122016-17122038 CATCCCAATCATATGGATCAAGG - Intergenic
952272103 3:31843260-31843282 CACCCATCTCCCATTGATCAAGG - Intronic
959863479 3:111241577-111241599 CAACCATGTCATCTGCAACAGGG + Intronic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
969444694 4:7237882-7237904 CACACATTTCAGATGGATCATGG - Intronic
979967786 4:127096497-127096519 CAAGCAGCTCATAAGGATAATGG + Intergenic
980635374 4:135495295-135495317 CAACCATCTCATAACAATCATGG - Intergenic
981329972 4:143497201-143497223 GGTCTATCTCATATGGATCAAGG - Intergenic
986901604 5:12441079-12441101 CAACTATCTTATATTGAACAAGG + Intergenic
990221650 5:53597331-53597353 TAACTTTCTCATATTGATCAAGG + Intronic
993323778 5:86508464-86508486 AAAATATCACATATGGATCAAGG - Intergenic
993515130 5:88822854-88822876 CAACCATCTCATATGGATCATGG - Intronic
993516557 5:88843275-88843297 TATCCATCTCACATGGATAATGG - Intronic
994626077 5:102220779-102220801 AAATCAACTCAAATGGATCAGGG - Intergenic
994762427 5:103872695-103872717 CAAGCATTTCAAATAGATCATGG + Intergenic
997723886 5:136104271-136104293 CAACCATCCCATGTTGATGAAGG - Intergenic
999919866 5:156306032-156306054 CAAACATCTCATCTGGGACAAGG - Intronic
1000736082 5:164902308-164902330 CTACCATAACATATGGCTCAAGG - Intergenic
1011724002 6:90189807-90189829 GAACCTTCTCATATGTGTCATGG - Intronic
1013971026 6:116018391-116018413 CTACCATCTGCTATGGATAATGG - Intronic
1016860646 6:148715618-148715640 CAACCTTCTCCTAATGATCAAGG - Intergenic
1017775803 6:157680005-157680027 CAACCATGTCAGATGCTTCAGGG - Intergenic
1018356637 6:163024360-163024382 CAACCATCTGATATTCAACAAGG - Intronic
1021940171 7:25671206-25671228 CAACCCTGTCATATGGTTGATGG + Intergenic
1022088376 7:27090741-27090763 CAGCCATCTCAGATGGATATTGG + Intergenic
1023658329 7:42448568-42448590 CAACCAGCTCTTATGGCTGAAGG + Intergenic
1024038937 7:45534398-45534420 CAACCATCTTATATGAATAATGG + Intergenic
1026895613 7:74008378-74008400 CAGCCATCTCAGATGGAAGAAGG + Intergenic
1028994546 7:97085798-97085820 CACCCATCTCATGTGGATTGAGG - Intergenic
1035524719 8:303673-303695 CAGTCATCTCATGTTGATCAGGG + Intergenic
1035524752 8:303869-303891 CAGCCATCTCATGTTCATCAGGG + Intergenic
1037979798 8:23244292-23244314 AAGCCAGCTCAAATGGATCATGG - Intronic
1039024172 8:33239704-33239726 CCACCATCTCCTATAGATTAGGG - Intergenic
1040382676 8:46888032-46888054 TCACCATCACATATGGATGAAGG - Intergenic
1046606787 8:116380492-116380514 CAATCATCTCATCTGGAAAATGG - Intergenic
1046697753 8:117360838-117360860 CAGACATCTGATATGGAGCAGGG + Intergenic
1048847803 8:138616618-138616640 CAACCACCTCACAAGGCTCAGGG + Intronic
1051619299 9:19035141-19035163 AAACCATATCAGATGGGTCAGGG - Intronic
1055178809 9:73356690-73356712 CATCCATTTCATAAAGATCAAGG + Intergenic
1058220398 9:102292696-102292718 CATTTATCACATATGGATCAGGG + Intergenic
1058268242 9:102934360-102934382 CAACCATTCCATATGCAGCAAGG - Intergenic
1059713548 9:116891836-116891858 CAACAATCCCATAAGGATGATGG - Intronic
1187356746 X:18581185-18581207 CTACCATATGATATAGATCATGG + Intronic
1190193769 X:48299489-48299511 CAAACATCTCATCTGGAGCTGGG + Intergenic
1190660283 X:52648118-52648140 CAAACATCTCATCTGGAGCTGGG + Intronic
1193107226 X:77689846-77689868 CTACCATCTTATTTTGATCAAGG - Intronic
1193883527 X:86956837-86956859 CAACCATCTCATTTTCAACAAGG - Intergenic
1194242413 X:91468469-91468491 CAACCATCTGATTTTCATCAAGG - Intergenic
1196022627 X:111006385-111006407 CAACAAACTCAAATGGATTAGGG + Intronic
1199463069 X:148105104-148105126 TAACCATCTGTAATGGATCAGGG + Intergenic