ID: 993516264

View in Genome Browser
Species Human (GRCh38)
Location 5:88839094-88839116
Sequence CTGTAGGCTCTGATAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993516264 Original CRISPR CTGTAGGCTCTGATAGAGCA AGG (reversed) Intronic
902378982 1:16043828-16043850 CTGGAGGCTCTGTGAGAGGAGGG + Exonic
903734725 1:25522860-25522882 CTGGAGGCTCAGAGAGGGCAAGG - Intergenic
904740113 1:32667767-32667789 CTGAAGTCTCTGATACAGCATGG + Intronic
905117832 1:35657934-35657956 CAGGAGGCCCTGAGAGAGCAAGG - Intergenic
905712793 1:40120929-40120951 ATGTAAGCTTTGAGAGAGCAGGG + Intergenic
909406102 1:75291403-75291425 CTGTAGGCTTTGGGAGAGCAAGG - Intronic
910750401 1:90622964-90622986 CTGTGGGCTCAAAGAGAGCAAGG - Intergenic
915057559 1:153149166-153149188 CTGTAGACTCTATAAGAGCAAGG + Intergenic
917263417 1:173194451-173194473 CTGTAGGCTTTGACAGCACAAGG + Intronic
917517949 1:175723478-175723500 CTGTAAGCTCCAAAAGAGCAAGG - Intronic
918192851 1:182192606-182192628 TTGTAGGCTCTGGTAGAGCTGGG + Intergenic
918728455 1:187956122-187956144 CTATAAGCTCTAAGAGAGCAGGG + Intergenic
920368140 1:205459110-205459132 CTGAAGGCTCTGGTAGAGGCAGG - Intergenic
920733952 1:208514179-208514201 CTGGAGGCCCTGTTAAAGCATGG - Intergenic
920840940 1:209553224-209553246 TTAGGGGCTCTGATAGAGCAGGG - Intergenic
923762248 1:236857673-236857695 CTGTAGGCTCTCAGAGGGTAGGG - Intronic
923824089 1:237479962-237479984 CTGTAAGCTCTATGAGAGCAGGG + Intronic
1064136572 10:12755810-12755832 CTGTAGGCTGTGATGAAGAAAGG - Intronic
1064889970 10:20160037-20160059 ATGTAGGCTCTGTGAGAGAAGGG + Intronic
1065663128 10:28026800-28026822 CTCTAGCCTGTGACAGAGCAAGG - Intergenic
1067826793 10:49580218-49580240 CTGGAGTCTCTGAAAGGGCAGGG + Intergenic
1071431798 10:85612416-85612438 CTGGAGGCTCAGATAGTACAGGG - Intronic
1076333199 10:129686794-129686816 TTGAAGGCTGTGATAGAGGAAGG + Intronic
1083426218 11:62588080-62588102 CTATAGGCTCTGTGAGAGCAGGG + Intronic
1084520340 11:69658798-69658820 GTGTAGGCTCTGGGAGGGCAGGG - Intronic
1084935644 11:72585191-72585213 CTGTAGGCTCCAATACAGCAGGG - Intronic
1085290463 11:75395651-75395673 CTGTAGGTTCTGTAAGAGCCTGG - Intergenic
1085604074 11:77881741-77881763 ATGTAGGCTTCTATAGAGCAGGG - Intronic
1086119848 11:83294447-83294469 CTGTAGGCTCTGCCAGGCCAGGG - Intergenic
1086668111 11:89510195-89510217 CTGTAAGATCTGAATGAGCAGGG - Intergenic
1089003189 11:115069029-115069051 CTGGAGTCTCTGTTAGTGCACGG - Intergenic
1089146748 11:116335038-116335060 CTGTAGGCTCTGCTGGGGCGAGG - Intergenic
1090674104 11:128973088-128973110 CTGTTGTCTCTGGTAGAGGATGG + Exonic
1090865362 11:130695847-130695869 CTGTAAGCTCTGTGAGAGCAGGG - Intronic
1093286702 12:17272544-17272566 ATGCAGGCTCTGAGAGAGTAGGG - Intergenic
1095194997 12:39303945-39303967 CTTTAGCCTCTGATAAAGAAGGG - Intronic
1097137617 12:56871761-56871783 GTGAAGGCTGTGACAGAGCAGGG + Intergenic
1100407330 12:94283115-94283137 CTGCAGGCTCTGTGAGGGCAGGG - Intronic
1101058004 12:100939550-100939572 CTGTAGGCTCTTGTAAAACAAGG + Intronic
1101142468 12:101810642-101810664 ATGTAGGCTCTGTGGGAGCAGGG - Intronic
1101720026 12:107342968-107342990 CTGTAAGCTCTTCTAGGGCAGGG + Intronic
1101844959 12:108355941-108355963 CTGTGAGCTCTGAGTGAGCAGGG - Intergenic
1104647294 12:130506213-130506235 CTGTACCCCCTGATAGAGCAAGG + Intronic
1107479982 13:40778135-40778157 ATGTAAGCTCTGGGAGAGCAGGG + Intergenic
1107809879 13:44189920-44189942 CTGTAGGCTCTGTGAGGTCAAGG + Intergenic
1108729781 13:53222870-53222892 CTGTTGTCTCTGATATAGGATGG + Intergenic
1118755909 14:68843577-68843599 CTGCAGGCTCTGTGAGGGCAGGG + Intergenic
1118985612 14:70752279-70752301 CTATAGGCTCCTAAAGAGCAGGG + Intronic
1121075294 14:91062969-91062991 CTGTAGGCTCTATAGGAGCAAGG - Intronic
1121940660 14:98067547-98067569 CTGTAAGCTCTGGGAGAGTAAGG - Intergenic
1125006519 15:34823421-34823443 TTGTGTGCTCTGCTAGAGCAAGG + Intergenic
1126489936 15:49225712-49225734 CTGTAGCCAGTGCTAGAGCAGGG - Intronic
1130638932 15:85652713-85652735 CTGTAGGCTCTGAGAGAAAATGG + Intronic
1130764754 15:86858636-86858658 ATGTAAGCTCTTAGAGAGCAAGG - Intronic
1131179855 15:90232319-90232341 CTGTGGGCTCTGGTAGAGAGAGG + Exonic
1132080661 15:98862209-98862231 CTGTAGCAGATGATAGAGCAGGG + Intronic
1133217048 16:4299012-4299034 ATAGAGGCTCTGATAGATCAGGG + Intergenic
1135864054 16:26084270-26084292 CTGGAGGCTCTGAAACATCAGGG - Intronic
1139963112 16:70729267-70729289 CTCTGGGCTCTTCTAGAGCAGGG - Intronic
1142441478 16:90101030-90101052 CTGTAGGCTCTAATGGGGGAAGG - Intergenic
1143003075 17:3807851-3807873 CTGTAAGCTCCGTGAGAGCAGGG - Intergenic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1145764603 17:27449701-27449723 TTGGAGGCTCTGATGAAGCATGG + Intergenic
1146676004 17:34774358-34774380 CTGGAGGCTCTGGGAGGGCAGGG - Intergenic
1146845109 17:36177659-36177681 CTCAAGTCTCTGATAGAACATGG - Intronic
1146880684 17:36440590-36440612 CTCAAGTCTCTGATAGAACATGG - Intergenic
1149125269 17:53222336-53222358 CTGTAGTATTTGAAAGAGCATGG + Intergenic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1151959628 17:77398823-77398845 CAGTAAGCTCTGAGACAGCAGGG - Intronic
1153204459 18:2682104-2682126 CTAGAGGCTCTGATAGAGATTGG + Intronic
1155856702 18:30843831-30843853 CTTTAGGCAATGATAGTGCATGG - Intergenic
1160522925 18:79519074-79519096 CTGAACGCTCTGGTAGAACAAGG - Intronic
1162459132 19:10803848-10803870 CTGCAGGCTCTGAAACAGCAGGG - Intronic
1165389859 19:35532509-35532531 CTGTAAGCTCTGAGAGGACAGGG - Intergenic
1166178778 19:41092633-41092655 CTTTAGGCTCAGAGAGACCAGGG - Intronic
1167252496 19:48407699-48407721 TTGTAAGCTCTGAGAGAGCAGGG - Intronic
1167600482 19:50451678-50451700 CTGTAGGGTCTGAGGGAGGAGGG + Intronic
931129004 2:59312000-59312022 CTGTAAGTTCTGAAGGAGCAGGG + Intergenic
932708847 2:74047561-74047583 CAGAAGGCTCTGAAGGAGCAGGG - Exonic
934603669 2:95678384-95678406 TTGTTGGCACTGAAAGAGCACGG + Intergenic
936537049 2:113320622-113320644 TTGTTGGCACTGAAAGAGCACGG + Intergenic
936749470 2:115623580-115623602 TTGTAAGCTCTGTTAAAGCAGGG - Intronic
937089853 2:119198932-119198954 CTGTAGGCTCTTAGAGAGGGTGG - Intergenic
941002184 2:160213738-160213760 CTGGAGGCTCTGAGGGAGAAGGG + Intronic
942150230 2:173069013-173069035 CTATAGACTCAGATAGATCAAGG + Intergenic
946644464 2:221818190-221818212 GTGCAGGCTCTGATAGGGCACGG - Intergenic
946824439 2:223662414-223662436 CTGTAGTCTCTAAAACAGCATGG + Intergenic
948277345 2:236719265-236719287 CGGGAGGGTCTGATAGTGCAGGG + Intergenic
948971066 2:241427547-241427569 CTTGAGGCTCTGATAGAAAATGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169071569 20:2735767-2735789 CTGTAAGCTCTCAGAGGGCAGGG - Intronic
1169352486 20:4880464-4880486 CTGTCAGCTCTGTGAGAGCAGGG - Intronic
1170153025 20:13245256-13245278 CTGTAGCCTGTGAGAGACCATGG - Intronic
1172857498 20:38017137-38017159 CTAGAGGCTCTGAGAGGGCAGGG + Intronic
1172877889 20:38177158-38177180 CTGTAGTCTGTGCCAGAGCATGG - Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1176161023 20:63648844-63648866 CTGTAGGCTCATACAGAGGAAGG + Intronic
1177127707 21:17216950-17216972 CTGCAGGCTGTGTGAGAGCAGGG + Intergenic
1177155812 21:17500312-17500334 CTGTAGGCTCTGTGAGGGCAGGG - Intergenic
1179028713 21:37701595-37701617 ATGTAAGCTCTGTGAGAGCAAGG - Intronic
1179551280 21:42145568-42145590 GTGAAGGCTCTGATGGAGGAGGG + Intergenic
1181088944 22:20458890-20458912 CTGCAGGCTCTGTAAGGGCAGGG + Intronic
1181311127 22:21945570-21945592 CTGCAGCCTTTGAGAGAGCATGG + Intronic
1182990755 22:34765215-34765237 CTCTAGGCTCTTGTACAGCAGGG - Intergenic
1184431653 22:44444633-44444655 CTGTGGGCCCTGCGAGAGCAGGG - Intergenic
950113159 3:10433370-10433392 CTCTAGGCTCTAACAGAGTAGGG + Intronic
954155451 3:48682670-48682692 CTGTAGGCTGGGGTGGAGCATGG - Intronic
954883021 3:53848468-53848490 CTGTAGGCTATGACGGACCATGG - Intronic
954955425 3:54514535-54514557 CTGTAAGCTCCAAGAGAGCATGG - Intronic
955794233 3:62618898-62618920 CTGTTAGCTCTGTGAGAGCAGGG - Intronic
959894393 3:111590136-111590158 CTGTGGGATCTGATAGAACTAGG + Intronic
960392950 3:117101866-117101888 GTGTTGGCTCTGCTAGAACATGG + Intronic
961137645 3:124526753-124526775 CTATAGTCTCTGATAGTGGAGGG - Intronic
962147446 3:132855399-132855421 CTGTAGGCTGTGTGGGAGCAGGG - Intergenic
962414493 3:135169631-135169653 CTGAAGGCTCTGATGGAGGGAGG + Intronic
962921654 3:139955772-139955794 CTCTATGCTCTGAGAGAGAAAGG + Intronic
965319106 3:167229583-167229605 CTGTAGGCTCAGATAGCACTTGG - Intergenic
966731457 3:183154785-183154807 CTGTATGACCTGATAGAGCTGGG + Intronic
967133834 3:186496589-186496611 CTGCAGCCTCTGAGAGAGCTGGG - Intergenic
968361736 3:198152006-198152028 CTGTAGGCTCTAATGGGGGAAGG - Intergenic
970883958 4:20965252-20965274 ATATAGGCTCTGAGATAGCAAGG - Intronic
971375263 4:26050987-26051009 CAGTAGGTTCTGGTAGAGCCCGG - Intergenic
975672762 4:76798326-76798348 CTGTAAGCCTTGAAAGAGCAGGG - Intergenic
976369186 4:84267399-84267421 CTGTAGGCAATGAGAAAGCATGG + Intergenic
976450587 4:85186013-85186035 CTGTAAGCTCTGTTAAAGCAAGG + Intergenic
977111850 4:92966459-92966481 CAGTGGGCTCTGATATAGCTTGG + Intronic
980838390 4:138226455-138226477 CTGGATGCTCAGATAAAGCAGGG - Intronic
981094562 4:140764955-140764977 CTTTAGCCTCTGATTGACCACGG + Intergenic
982437660 4:155397397-155397419 TTGGAGGCTCTGATAAAGCCTGG + Intergenic
982793498 4:159618994-159619016 CTGTAGATTCTGGTAGGGCATGG + Intergenic
987713313 5:21532722-21532744 CTGGAGGCTGTCAAAGAGCATGG - Intergenic
993516264 5:88839094-88839116 CTGTAGGCTCTGATAGAGCAAGG - Intronic
999820577 5:155223827-155223849 CTGTGAGCTCTGTGAGAGCAGGG + Intergenic
1000408019 5:160909133-160909155 ATGAAGGCTCTGATAGAGAAGGG + Intergenic
1000637508 5:163660643-163660665 CTGTAAACTCTTAAAGAGCAAGG + Intergenic
1001085759 5:168699108-168699130 CTGCTGGCTCACATAGAGCAGGG - Intronic
1001574309 5:172751924-172751946 CTGTAGGCACTGGTAGGGCAGGG - Intergenic
1002304587 5:178275712-178275734 GTGCAGGCTCTGAAAGAGTAGGG - Intronic
1002453354 5:179331752-179331774 CTGGGGGCTCTGATAGAACAAGG - Intronic
1003185295 6:3825246-3825268 CTGTAGGCCCTGTGAGTGCAGGG - Intergenic
1006180923 6:32153009-32153031 CTGTAGTCTCTGCTAGGACATGG - Intronic
1007740665 6:44007826-44007848 CTGTAGGCTCTAGGAGGGCAGGG - Intergenic
1007759046 6:44121532-44121554 ATGTATGCTCTGTGAGAGCAGGG + Intronic
1010425624 6:75725940-75725962 CTATTGACACTGATAGAGCAAGG - Intergenic
1010930906 6:81801787-81801809 CTGTAGGCTCATATAGCGAAAGG - Intergenic
1011705175 6:89994020-89994042 CTTTAGGCTCTGGTTGAGTATGG - Intronic
1012942244 6:105427560-105427582 CTGTAGGCTCTGATATGGTTTGG - Intergenic
1013339464 6:109199285-109199307 CTGTAGGCTGTGAGATGGCAAGG + Intergenic
1017431702 6:154377897-154377919 CACCAGGCTCTGAGAGAGCAAGG - Intronic
1018574141 6:165241162-165241184 CTTGAGGCTATGATAGAACAGGG + Intergenic
1019253945 7:36716-36738 CTGTAGGCTCTAATGGGGGAAGG + Intergenic
1021863386 7:24929990-24930012 CTCTGGGTTCTCATAGAGCAAGG + Intronic
1022841450 7:34168017-34168039 CTGAAACCTCTGATAGGGCATGG + Intergenic
1023216620 7:37869667-37869689 CTGTAGACTGTGCCAGAGCAAGG - Intronic
1028124248 7:87093751-87093773 CTGTTGGCTCTGTTAGAGAAGGG + Intergenic
1028455457 7:91033527-91033549 CTGTAGATTCTGATTCAGCAGGG + Intronic
1032233668 7:130100395-130100417 CTGTAAGCTCTGTAAGGGCAGGG + Intronic
1034950945 7:155297160-155297182 ATGTAGGCTCTGAGCGGGCACGG + Intergenic
1035081714 7:156221823-156221845 CTGCAGCCTCTGATAAAGAAAGG - Intergenic
1035277088 7:157754133-157754155 CTGTGGGCTCAGGAAGAGCAGGG + Intronic
1036755315 8:11467352-11467374 CTCTGGGCTCTGATGCAGCAGGG - Intronic
1037506363 8:19533645-19533667 CTGTAAGCTCTTTGAGAGCAAGG + Intronic
1038991956 8:32877837-32877859 ATGTAAGCTCAGTTAGAGCAGGG + Intergenic
1040521549 8:48180593-48180615 CTGCAGGCTCAGGTAGAGGAAGG - Intergenic
1043876568 8:85492717-85492739 CTGAAGGCTCTGATACTGAAAGG + Intergenic
1045243623 8:100423946-100423968 ATGTAAGCTCTGTGAGAGCAGGG - Intergenic
1046852016 8:118985113-118985135 CTGTACCCTCAGAGAGAGCATGG + Intergenic
1049101239 8:140580426-140580448 CTGCAGCCTCTGTGAGAGCAAGG - Intronic
1049122368 8:140750676-140750698 ATGTAAGCTCTTAAAGAGCAAGG - Intronic
1049479727 8:142816170-142816192 CTGTAGGCCCTGCAGGAGCAAGG - Intergenic
1049981670 9:909423-909445 CTGTAGGCTCAGACAGTTCACGG + Intronic
1050267996 9:3911233-3911255 CTGTAAACTCTGTGAGAGCAGGG - Intronic
1051178143 9:14381787-14381809 ATGTAAGCTCTGAAAGGGCAGGG + Intronic
1055702516 9:78961137-78961159 CTGTAGGCTCTGTAATAGCAAGG + Intergenic
1056879729 9:90379717-90379739 ATGTAAGCTCTGATTGAGGATGG + Intergenic
1057330375 9:94108853-94108875 CTGTGGCATCTGAGAGAGCAGGG - Exonic
1058154767 9:101502779-101502801 CTGAAGACTCTGACAGAGCCAGG - Intronic
1058640678 9:107080930-107080952 CTGTAGGCTCTTTGAGGGCAGGG + Intergenic
1060020828 9:120129726-120129748 CTGCAGGTTTTGAGAGAGCAGGG - Intergenic
1060702272 9:125766079-125766101 CTGTAGGTTCTTAGAGGGCAGGG + Intronic
1062746453 9:138215827-138215849 CTGTAGGCTCTAATGGGGGAAGG - Intergenic
1186409216 X:9331370-9331392 CAGGAGGCTCTGATACAGTAAGG + Intergenic
1187172150 X:16862503-16862525 CTGTAGGCACTGGTATAGGAAGG - Intronic
1188504098 X:30862560-30862582 CTGAAGGCTCTGACAAAGCTAGG - Intronic
1188692321 X:33145483-33145505 ATGTAGGCTCTGTGGGAGCAGGG + Intronic
1189989690 X:46582483-46582505 CTGTAGGGTCAGAGAGAGCCAGG - Intronic
1193817564 X:86122287-86122309 CTGTGGGCTGTGTGAGAGCAGGG - Intergenic
1196940489 X:120771081-120771103 CTGGAGGCTCTGACACAGTATGG + Intergenic