ID: 993516411

View in Genome Browser
Species Human (GRCh38)
Location 5:88841249-88841271
Sequence TCCCAAAGTTCAGGGAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337943
Summary {0: 1, 1: 3, 2: 310, 3: 15213, 4: 322416}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993516411_993516417 23 Left 993516411 5:88841249-88841271 CCTGCACTCCCTGAACTTTGGGA 0: 1
1: 3
2: 310
3: 15213
4: 322416
Right 993516417 5:88841295-88841317 AGCCCAGTTCGAGACCAGTCTGG 0: 1
1: 11
2: 157
3: 504
4: 1259
993516411_993516416 -8 Left 993516411 5:88841249-88841271 CCTGCACTCCCTGAACTTTGGGA 0: 1
1: 3
2: 310
3: 15213
4: 322416
Right 993516416 5:88841264-88841286 CTTTGGGAGGCTGAGGCAGATGG 0: 1457
1: 29525
2: 84197
3: 163693
4: 170597
993516411_993516418 24 Left 993516411 5:88841249-88841271 CCTGCACTCCCTGAACTTTGGGA 0: 1
1: 3
2: 310
3: 15213
4: 322416
Right 993516418 5:88841296-88841318 GCCCAGTTCGAGACCAGTCTGGG 0: 1
1: 11
2: 120
3: 369
4: 2081

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993516411 Original CRISPR TCCCAAAGTTCAGGGAGTGC AGG (reversed) Intronic
Too many off-targets to display for this crispr