ID: 993518615

View in Genome Browser
Species Human (GRCh38)
Location 5:88869552-88869574
Sequence CTGCATATGCAGATAGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993518615 Original CRISPR CTGCATATGCAGATAGATAA TGG (reversed) Intronic
909602518 1:77475225-77475247 CTCCATATATAGATATATAAAGG + Intronic
910966421 1:92812438-92812460 TTGCATATGGTGAGAGATAAGGG - Intergenic
911176652 1:94824407-94824429 CTGCAGATGCTGATATAAAACGG - Intronic
912000219 1:104823729-104823751 CTGCAAATGCAGACTGATAAAGG - Intergenic
912907672 1:113723594-113723616 TTGCATATGGTGAGAGATAAGGG - Intronic
913455580 1:119027145-119027167 CTGCATTTACAGATAGGAAATGG + Intergenic
918449938 1:184648408-184648430 CTGCAAATGCAGATTGGTACAGG + Intergenic
918867218 1:189917717-189917739 TTGTATATGCTGAGAGATAAGGG + Intergenic
919303288 1:195797813-195797835 TTTCATATGGAGAGAGATAATGG - Intergenic
919477742 1:198050174-198050196 TTGTATATGGTGATAGATAAGGG + Intergenic
919643494 1:200067844-200067866 CTACGTATGCAGAGAAATAATGG + Intronic
921644038 1:217591215-217591237 ATACATATGCATATATATAATGG + Intronic
922684783 1:227630735-227630757 GTCCAAAAGCAGATAGATAAAGG - Intronic
923365063 1:233251634-233251656 TTGCATGTGCAGAAATATAAGGG - Intronic
923954939 1:239005746-239005768 GTGCATATAGAGATATATAATGG + Intergenic
1063549902 10:7021518-7021540 CTACATAAGCTGAAAGATAAGGG + Intergenic
1063962280 10:11316635-11316657 CTCCATATGGAAACAGATAATGG - Intronic
1064771721 10:18730294-18730316 CTGCAAATGCACACAGAAAAGGG - Intergenic
1065758456 10:28957860-28957882 TTGCATATGGTGAGAGATAATGG - Intergenic
1072575559 10:96696710-96696732 CTTCATATCCACACAGATAATGG + Intronic
1072841132 10:98775061-98775083 CTCCATATGCTGAGAGATACAGG + Intronic
1074708490 10:116157530-116157552 CAGCATATGCAGAAACATGAAGG - Intronic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1078876694 11:15406339-15406361 CTTCATTTACAGATACATAAAGG - Intergenic
1081647274 11:44798818-44798840 AGGGATATGAAGATAGATAAAGG + Intronic
1082683461 11:56208616-56208638 GTGCATATTCAGAGAGAAAAAGG - Intergenic
1085907042 11:80776025-80776047 CTGGATATGCAGCTACATAAGGG - Intergenic
1086025493 11:82285335-82285357 CTGCATATGTTAATACATAATGG - Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086546786 11:88005772-88005794 CTGTATATGGTGAGAGATAAGGG + Intergenic
1086971047 11:93081283-93081305 GTGCATATTCAGAGAGGTAAAGG - Intergenic
1090975478 11:131676521-131676543 CTGCATATGCACATAGTGGAGGG + Intronic
1092519983 12:9260657-9260679 CTGAATTTGAAGATAGAGAAAGG + Intergenic
1093065023 12:14648619-14648641 GTGCACATTCAGAGAGATAAAGG - Intronic
1095386351 12:41655063-41655085 TTGCATATGTGGAAAGATAAAGG - Intergenic
1096887502 12:54732306-54732328 CTGAACATGCAGAAAAATAATGG - Intergenic
1097902444 12:64886638-64886660 CTACATATGTAGAGAGATATAGG + Intergenic
1098539891 12:71642742-71642764 CTGTATAATCAGATAGAAAATGG + Intronic
1098932370 12:76434322-76434344 CTGCATATGGTGTGAGATAAGGG - Intronic
1099589337 12:84567547-84567569 CTGCATAATCAAATAGATGAGGG - Intergenic
1099749909 12:86760237-86760259 TTGCATATGGTGAGAGATAAGGG - Intronic
1101070526 12:101070483-101070505 TTGTATATGCGGAAAGATAAGGG - Intronic
1101171613 12:102102772-102102794 CTGCATATGGAGTGAAATAACGG + Intronic
1101268500 12:103117610-103117632 CTGCAGATGCAGATAGCAACAGG - Intergenic
1101453245 12:104801301-104801323 CTGCATATTCAGGGAGGTAAAGG - Intergenic
1101647465 12:106644733-106644755 CTGCAGATGAAGATATAAAATGG - Intronic
1102610759 12:114110036-114110058 CTGCACATGCAGATAGATTCTGG + Intergenic
1105460061 13:20576541-20576563 TTGCATATGGTGAGAGATAAGGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107668825 13:42721740-42721762 CTGCAAATGCAAATATATAAAGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108190025 13:47928860-47928882 CTGCATATGCAGAAAGCACATGG + Intergenic
1108252159 13:48578181-48578203 CTGCCTGTGCAAATACATAAGGG - Intergenic
1109729997 13:66400526-66400548 CTGCAAATGCAAATTTATAAAGG - Intronic
1109983215 13:69938548-69938570 CTCCATATCCAGAGGGATAATGG - Intronic
1110275365 13:73636007-73636029 CTGCACATGCAGACAGCCAAAGG + Intergenic
1110930523 13:81210391-81210413 CTGTGAATGCAGACAGATAAAGG - Intergenic
1111426644 13:88093466-88093488 TTGCATATGGTGAGAGATAAGGG + Intergenic
1111609754 13:90588353-90588375 CTTCATTTGCAGTTAGAGAAGGG - Intergenic
1112233617 13:97614178-97614200 CTGCATATTCAGGGAGGTAAAGG + Intergenic
1113101679 13:106726642-106726664 CTGCATATTCAGGGAGGTAAAGG + Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116602674 14:46947251-46947273 CTTGACATGCAGAGAGATAATGG - Intronic
1120587082 14:86325586-86325608 CTGCATATGTAGAGAGAAATAGG + Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1127159213 15:56163851-56163873 GTACATATGAGGATAGATAATGG - Intronic
1127863972 15:63016686-63016708 CCACATATGAAGATAGCTAAGGG + Intergenic
1130817471 15:87453098-87453120 CTTCAGATACAGATAGATAATGG + Intergenic
1130980788 15:88810575-88810597 CTGCATATCCAGATGGCTCAGGG + Intronic
1132516013 16:366402-366424 CTGCATGTGCAGAATGACAAGGG - Intergenic
1138401835 16:56751963-56751985 ATGCATATGCAGGGAGAGAAAGG - Intronic
1138649906 16:58453994-58454016 CTGGATTTGAAGATAGAGAAAGG - Intergenic
1140329849 16:74044845-74044867 ATGCATTGGCAGATACATAATGG - Intergenic
1140591803 16:76362702-76362724 GTGCATATGGAGATAAAGAAGGG + Intronic
1141044184 16:80701247-80701269 ATGCATATGCAAATATATAAAGG + Intronic
1141242562 16:82276738-82276760 CACCAGATCCAGATAGATAAAGG - Intergenic
1141356181 16:83349037-83349059 CTGCACATACAGATAAATATGGG - Intronic
1141541130 16:84722496-84722518 CTGCTGGTGCAGATAGAAAACGG - Intronic
1146402610 17:32511830-32511852 CTGAATAAGCAAATATATAATGG - Intronic
1150871148 17:68911770-68911792 CTCCATTTGGAGAAAGATAAGGG + Intronic
1151638652 17:75372261-75372283 GTGCAGAGGCAGATAGATACTGG - Intronic
1153391856 18:4571154-4571176 CTGTATATGCTGAGAGATAGGGG + Intergenic
1155549916 18:26954000-26954022 CTACATGTGCAGATCTATAATGG - Intronic
1155860688 18:30894430-30894452 CTGCAAATTCAGAAAGTTAATGG - Intergenic
1155914249 18:31540342-31540364 CTACATATACAGATACATAACGG + Intronic
1157468983 18:47973319-47973341 CTGGAAAAGCAGCTAGATAAGGG + Intergenic
1159047264 18:63381265-63381287 CAGCATATGCAGATAGGAAAGGG - Intergenic
1159444253 18:68521339-68521361 CTGAATATTCAGACATATAAAGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159730972 18:72027226-72027248 CTGTATATGGTGAGAGATAAGGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1161909809 19:7184716-7184738 CTGCATATGCAGACAGGAATTGG - Intronic
1164276681 19:23724775-23724797 CTGCATTTTCAGATTAATAATGG + Intergenic
1164549429 19:29196571-29196593 ATGCATATGCAGAAAGAGATTGG - Intergenic
1165557809 19:36650272-36650294 CTGTATATTCATATATATAAAGG - Intronic
926038426 2:9653503-9653525 ATGCATATGGAAATAGACAAAGG - Intergenic
926706343 2:15840460-15840482 CTGCAAATGCAGGTTGAAAAAGG - Intergenic
927408268 2:22796836-22796858 CTGCAGAGGCAGATACAGAAGGG + Intergenic
929280623 2:40073981-40074003 CTGTATATACAGAAAGGTAAGGG + Intergenic
931266314 2:60663426-60663448 CTGAATAGGCAAATAGATAGGGG - Intergenic
932927683 2:75995288-75995310 ATGGATATGCAGAAAGATATAGG - Intergenic
933147433 2:78871844-78871866 GTGCATATTCAGGGAGATAAAGG + Intergenic
933623933 2:84576736-84576758 CAGCATATGCAAATTGACAAAGG + Intronic
935633842 2:105234607-105234629 CTACAGATTCAGATAGATTATGG - Intergenic
936715446 2:115181955-115181977 CTGCATGTGTTGATAGATTATGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937827930 2:126388310-126388332 CTGCAGAGGCAGAGACATAATGG + Intergenic
940547767 2:155110918-155110940 CTGCACATGCACAGAGAAAAGGG - Intergenic
940584241 2:155624328-155624350 TTGCAAATGCAGATAGATGCAGG - Intergenic
941618109 2:167745793-167745815 ATGCATCCACAGATAGATAATGG - Intergenic
941739747 2:169022032-169022054 ATACATATGCAGATAAATATGGG + Intronic
942738024 2:179139044-179139066 GTGCATATTCAGAGAGGTAAAGG - Intronic
944540067 2:200746130-200746152 CTTCATATGAAGACAGATCAGGG - Intergenic
946072528 2:217046784-217046806 CTGCTTATGAAGACAGACAATGG - Intergenic
946120840 2:217512679-217512701 ATGCAGATGCAGAGAGATAGAGG - Intronic
946623605 2:221587149-221587171 CTTCATATGCACAGAGAAAAGGG + Intergenic
947938766 2:234029988-234030010 CTGCATATGCAGGTATAATATGG + Intergenic
1170209367 20:13833177-13833199 CTGCAAATGCAGAATGAAAATGG - Intergenic
1170688473 20:18589846-18589868 CTGCATATTAAAAAAGATAAGGG + Intronic
1171336127 20:24387387-24387409 CTGAATATGAAGACAGATTAGGG + Intergenic
1172439363 20:34954911-34954933 CTGGAAATGGAGATAAATAAAGG - Intronic
1174349965 20:49960049-49960071 CTGCATATTCAGGGAGGTAAAGG - Intergenic
1174993771 20:55543029-55543051 CTGCATTTGCAGAAAGACAAGGG + Intergenic
1177624146 21:23637074-23637096 TTGTATATGAAAATAGATAAGGG + Intergenic
1177829285 21:26118980-26119002 GTGAACATGCAGATAGAAAAAGG + Intronic
1178141040 21:29683793-29683815 TTGCATATGTAAATAGCTAAAGG - Intronic
1178769273 21:35487864-35487886 CTGGATAAGCACATAAATAAGGG - Intronic
1182850841 22:33472898-33472920 CTACAAATGCAGAAAGATACAGG - Intronic
1183010005 22:34937933-34937955 TTGTATATGGTGATAGATAAGGG - Intergenic
949358858 3:3210432-3210454 CTCCAAAGCCAGATAGATAAAGG - Intergenic
949774899 3:7622013-7622035 CTGCGAATGCTGAGAGATAATGG - Intronic
950982631 3:17325143-17325165 CTGCATATGTAGATTTGTAATGG + Intronic
951587929 3:24234333-24234355 CTTAAAATGCAGATAGCTAATGG + Intronic
953353776 3:42236629-42236651 CTGTATATGGAGAGAGATAGGGG - Intergenic
953463421 3:43099555-43099577 CTGCATACCCAGACAGGTAAAGG + Intronic
955838882 3:63090048-63090070 CTGCATATGAAGAGAGATAAAGG - Intergenic
957445686 3:80310813-80310835 CTCCATATTCATGTAGATAATGG - Intergenic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
957771363 3:84696428-84696450 CTGGTTTTGAAGATAGATAAAGG + Intergenic
957955075 3:87176005-87176027 CTGGTTATACAGATAGAAAATGG - Intergenic
959132730 3:102377827-102377849 CAGCATATGAAGCTACATAAAGG + Intronic
960211465 3:114972073-114972095 CTGCATAGTGAGATAAATAAAGG - Intronic
963220649 3:142807944-142807966 GTGAAACTGCAGATAGATAAAGG - Intergenic
964829141 3:160863855-160863877 CTGCATTTTCAGATGCATAAGGG - Intronic
964896464 3:161602471-161602493 CTGCATATTCAGAGAGATAAAGG + Intergenic
965169947 3:165250120-165250142 ATGCATATTCAGAAAGGTAAAGG + Intergenic
967546553 3:190736896-190736918 CTGCAAATTCAGATGGATCATGG - Intergenic
967660360 3:192100783-192100805 TTGAATATGCAGATAAATATGGG - Intergenic
969067824 4:4502782-4502804 CTGCATAGGAAGACAGATGAAGG - Intronic
970338136 4:15074508-15074530 CTGCATATACAGTTAGAAAAAGG + Intergenic
970626140 4:17885466-17885488 CTTCCTATGCAGTTAGTTAATGG + Intronic
974154800 4:58057166-58057188 CTGAGTTTGCAGAAAGATAAAGG - Intergenic
975968716 4:80007698-80007720 CTGGCTTTGCAGATAGAGAAAGG + Intronic
976863046 4:89689531-89689553 ATGGAAATGCATATAGATAATGG + Intergenic
977227953 4:94415740-94415762 TTGCATATGGTGAGAGATAAGGG + Intergenic
977456915 4:97273082-97273104 CAGCATTTGCTGATATATAAAGG - Intronic
977762384 4:100754746-100754768 CTGTATATGGTGATAGATAGGGG - Intronic
978676957 4:111329798-111329820 CTGTATATGCTGTGAGATAAGGG - Intergenic
979066869 4:116148493-116148515 CTGCATAGTCAGATACTTAAAGG - Intergenic
979754138 4:124318587-124318609 CTGTATATGCAGTGAGAAAAGGG - Intergenic
980334432 4:131452324-131452346 ATACATATGCAGATAGAGAAAGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
984420983 4:179521043-179521065 TTTCAAATTCAGATAGATAATGG - Intergenic
985480502 5:107502-107524 CTGCATGAGCAGATGGGTAAGGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986818852 5:11443503-11443525 AAGCATGTGCAGATAGATACAGG + Intronic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
986979029 5:13425234-13425256 CAGCATATGCTGATTGATGATGG + Intergenic
987905817 5:24075698-24075720 CTGCATGTGCAGAGAGAGAATGG + Intronic
987945797 5:24606799-24606821 CTGCATATTTAGATATATAATGG - Intronic
989546459 5:42680355-42680377 CTGCATATGCAGTCAAACAAGGG - Intronic
990244473 5:53850657-53850679 CAACATATGCAAATAAATAAAGG - Intergenic
993518615 5:88869552-88869574 CTGCATATGCAGATAGATAATGG - Intronic
993756518 5:91737426-91737448 CTGGATATGCAGGTAGCAAATGG + Intergenic
995022135 5:107379030-107379052 CTGCATATATAAATAGCTAAAGG + Exonic
995153124 5:108875051-108875073 GTACATATTCAGATAGGTAAAGG - Intronic
995808988 5:116084382-116084404 CTGCAGATGCAGATACAGGAGGG + Intergenic
997164114 5:131640209-131640231 CTGCTTAGGCAGATAGAAATGGG - Intronic
997334617 5:133098100-133098122 GAGCATATGCAGAAATATAATGG - Intronic
1000310834 5:160043023-160043045 CTGCTTATGGAGATACAGAATGG - Intronic
1001667182 5:173443004-173443026 ATGGATATGCAGTTACATAAAGG + Intergenic
1006770185 6:36546927-36546949 CTGCAAAAGGAGAAAGATAAAGG + Intronic
1006911643 6:37567021-37567043 ATACATATGCAGATAAATGATGG - Intergenic
1007039515 6:38709070-38709092 GTGCATATTCAGGGAGATAAAGG + Intergenic
1008235786 6:49047657-49047679 CTGCATATCCATTTAGATACCGG + Intergenic
1008523168 6:52381778-52381800 CTGTGTATGCATAAAGATAAAGG - Intronic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009500228 6:64403815-64403837 CTGCTTATGTAGAGAAATAAAGG + Intronic
1009648167 6:66436115-66436137 ATACATATGCACATATATAAAGG - Intergenic
1009856146 6:69266807-69266829 ATGCATATTCAGAAAGGTAAAGG + Intronic
1011114161 6:83872175-83872197 CTGAATGTGCAAAAAGATAATGG - Intronic
1011231911 6:85171251-85171273 CTGCATGTGTAGAGAGGTAAGGG - Intergenic
1011787360 6:90862123-90862145 CTTCATATGCAGAGTGAAAAAGG - Intergenic
1012342192 6:98141392-98141414 TTACATATGTAGAAAGATAATGG - Intergenic
1013863996 6:114672783-114672805 CTGCAAGAGCAGATAGGTAATGG - Intergenic
1013959195 6:115877705-115877727 CAGCATATTCAGATAGAATAAGG + Intergenic
1014194523 6:118538429-118538451 ATGCATATGCATGAAGATAAAGG + Intronic
1015608464 6:134987070-134987092 CTGCATATGTATTTAGAAAATGG - Intronic
1016705026 6:147096832-147096854 TTGCATATGCAAATACATCAAGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016959683 6:149660794-149660816 CTGCATATACAGATTGTTATTGG - Exonic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018545480 6:164930904-164930926 CTGTATATTCATATATATAATGG + Intergenic
1018815641 6:167328584-167328606 CTGCATATGCACCTAGAACAAGG - Intronic
1018818506 6:167354592-167354614 CTGCATCTGCAGATAGATACAGG - Intronic
1019153840 6:170025942-170025964 CTGCATATGCAGGTTCAAAAGGG - Intergenic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1021101252 7:16587326-16587348 ATGCCTATGCAGATAAAGAAGGG - Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1026696363 7:72596599-72596621 TTGCATATGGTGTTAGATAAGGG - Intronic
1029048092 7:97652857-97652879 CTGTATTTACAGATAGATACTGG + Intergenic
1030447362 7:109663954-109663976 CTGGATATACAGATAGATTCTGG + Intergenic
1030504032 7:110397157-110397179 CTCCATATACATAGAGATAAAGG + Intergenic
1030663058 7:112243147-112243169 TTGCATATGGTGATAGATATGGG - Intronic
1031140263 7:117935025-117935047 ATGTATATGTATATAGATAAGGG + Intergenic
1031211207 7:118828851-118828873 CTGCAGATAGAGATAGGTAATGG - Intergenic
1032571151 7:132999157-132999179 CTGGAAATGCAGATAAATATTGG - Intronic
1033463961 7:141574019-141574041 TTGTATATGCAAATACATAATGG + Intronic
1033854350 7:145539841-145539863 ATGCATATGGAGAAAGAAAAAGG + Intergenic
1034207272 7:149328817-149328839 CTGCATATTCAGGGAGGTAAAGG - Intergenic
1037152254 8:15651571-15651593 GTGCATGTGCAGAGAGAAAAGGG + Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038893541 8:31754932-31754954 CTACCTATTCAGGTAGATAAGGG + Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040615729 8:49036448-49036470 TTGTATATGGAGATACATAAGGG - Intergenic
1043224305 8:77703426-77703448 CTGCATATGATGTTACATAAAGG + Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044541700 8:93415741-93415763 CTGAATATGTAGATAAATTATGG - Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045938011 8:107705490-107705512 CTGCTTATGCAGATAAGGAAGGG - Intergenic
1046363515 8:113193566-113193588 ATGCATAAGAATATAGATAATGG - Intronic
1047902261 8:129436151-129436173 TTGCATATGCAATTAGATTAAGG + Intergenic
1048520102 8:135145967-135145989 ATCCATATGCAGAAAGAGAATGG - Intergenic
1049343023 8:142123891-142123913 CAGCTTATGAAGATACATAAAGG + Intergenic
1050778678 9:9302400-9302422 TTGCATATGCAGCTGGAGAAGGG - Intronic
1050867711 9:10524155-10524177 CTCCAGATGCAGTTACATAAGGG + Intronic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051450079 9:17187061-17187083 CTGAAAATGCAGGTAGATCAGGG - Intronic
1053590472 9:39509336-39509358 TTGCATATGGTGAGAGATAAGGG - Intergenic
1053613448 9:39739592-39739614 CAGCACTTGCAGATAGATAGTGG + Intergenic
1053848333 9:42264734-42264756 TTGCATATGGTGAGAGATAAAGG - Intergenic
1053871490 9:42497549-42497571 CAGCACTTGCAGATAGATAGTGG + Intergenic
1054240066 9:62602805-62602827 CAGCACTTGCAGATAGATAGTGG - Intergenic
1054554199 9:66637331-66637353 CAGCACTTGCAGATAGATAGTGG - Intergenic
1054575831 9:66855953-66855975 TTGCATATGGTGAGAGATAAGGG + Intergenic
1054782244 9:69175855-69175877 CTACTTATGCAGATTGATGAAGG + Intronic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1056998082 9:91482864-91482886 CTGCACATGTATATAGGTAATGG + Intergenic
1057770675 9:97965075-97965097 GTCCATATCCAGATAGACAAAGG + Intergenic
1058595953 9:106615836-106615858 CTGCATAAGCAGATGAAAAAAGG + Intergenic
1059083476 9:111274687-111274709 CTACATATTCAGATACATACAGG + Intergenic
1185544132 X:928315-928337 ATACATAGACAGATAGATAATGG - Intergenic
1186273582 X:7916695-7916717 CTGCAAATGCAGATAATTTAGGG - Intronic
1186762174 X:12734575-12734597 CTTCTTATGCAGATAGAAACAGG - Intergenic
1188264984 X:28062174-28062196 TTGTATATGGAGAGAGATAAGGG + Intergenic
1189584977 X:42450325-42450347 GGGCATATCCAGATATATAAAGG + Intergenic
1189769061 X:44404428-44404450 TTGCATATGGTGAAAGATAAGGG + Intergenic
1191105278 X:56768552-56768574 CAGCAGATGGAGAAAGATAAAGG - Intergenic
1191106271 X:56773954-56773976 CAGCAGATGGAGAAAGATAAAGG - Intergenic
1191107264 X:56779356-56779378 CAGCAGATGGAGAAAGATAAAGG - Intergenic
1191610894 X:63111990-63112012 CAACATATGCAGATAAAAAAAGG + Intergenic
1191612228 X:63129687-63129709 CTGCAAATGAAGATTCATAAAGG - Intergenic
1191624069 X:63249239-63249261 CTGCAAATGAAGATTCATAAAGG + Intergenic
1193864801 X:86718650-86718672 TTGAATATGCTGAAAGATAAGGG + Intronic
1194376972 X:93148693-93148715 ATTAATATGCAAATAGATAAAGG + Intergenic
1199133724 X:144227019-144227041 ATGCATATATGGATAGATAATGG - Intergenic
1200136294 X:153876267-153876289 CTGCACATGCAGACACATACGGG - Intronic
1200275470 X:154728232-154728254 CTCCAAATGCAGATAGGTATAGG - Intronic