ID: 993521234

View in Genome Browser
Species Human (GRCh38)
Location 5:88904264-88904286
Sequence TAGGGGGTCGGGAGGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10292
Summary {0: 2, 1: 0, 2: 4, 3: 456, 4: 9830}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993521234_993521248 10 Left 993521234 5:88904264-88904286 CCCTCCCCCCTCCCGACCCCCTA 0: 2
1: 0
2: 4
3: 456
4: 9830
Right 993521248 5:88904297-88904319 TCCAATGGAAAATATCCAATCGG No data
993521234_993521246 -5 Left 993521234 5:88904264-88904286 CCCTCCCCCCTCCCGACCCCCTA 0: 2
1: 0
2: 4
3: 456
4: 9830
Right 993521246 5:88904282-88904304 CCCTATGCTGCTAGTTCCAATGG 0: 2
1: 0
2: 1
3: 3
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993521234 Original CRISPR TAGGGGGTCGGGAGGGGGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr