ID: 993521930 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:88913693-88913715 |
Sequence | GAGAAGAGGGGGTGAGTTTT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
993521930_993521937 | -1 | Left | 993521930 | 5:88913693-88913715 | CCCAAAACTCACCCCCTCTTCTC | No data | ||
Right | 993521937 | 5:88913715-88913737 | CAGTGTCAGGAAAACCTCTTTGG | No data | ||||
993521930_993521938 | 10 | Left | 993521930 | 5:88913693-88913715 | CCCAAAACTCACCCCCTCTTCTC | No data | ||
Right | 993521938 | 5:88913726-88913748 | AAACCTCTTTGGAGTTCTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
993521930 | Original CRISPR | GAGAAGAGGGGGTGAGTTTT GGG (reversed) | Intergenic | ||