ID: 993521936

View in Genome Browser
Species Human (GRCh38)
Location 5:88913707-88913729
Sequence GTTTTCCTGACACTGAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993521936_993521940 25 Left 993521936 5:88913707-88913729 CCTCTTCTCAGTGTCAGGAAAAC No data
Right 993521940 5:88913755-88913777 TGTCTGAGTCAGTGCTTATGTGG No data
993521936_993521938 -4 Left 993521936 5:88913707-88913729 CCTCTTCTCAGTGTCAGGAAAAC No data
Right 993521938 5:88913726-88913748 AAACCTCTTTGGAGTTCTATTGG No data
993521936_993521941 26 Left 993521936 5:88913707-88913729 CCTCTTCTCAGTGTCAGGAAAAC No data
Right 993521941 5:88913756-88913778 GTCTGAGTCAGTGCTTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993521936 Original CRISPR GTTTTCCTGACACTGAGAAG AGG (reversed) Intergenic