ID: 993521939

View in Genome Browser
Species Human (GRCh38)
Location 5:88913729-88913751
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993521939_993521942 11 Left 993521939 5:88913729-88913751 CCTCTTTGGAGTTCTATTGGACT No data
Right 993521942 5:88913763-88913785 TCAGTGCTTATGTGGGTTGCTGG No data
993521939_993521943 24 Left 993521939 5:88913729-88913751 CCTCTTTGGAGTTCTATTGGACT No data
Right 993521943 5:88913776-88913798 GGGTTGCTGGAATATTTACCAGG No data
993521939_993521941 4 Left 993521939 5:88913729-88913751 CCTCTTTGGAGTTCTATTGGACT No data
Right 993521941 5:88913756-88913778 GTCTGAGTCAGTGCTTATGTGGG No data
993521939_993521940 3 Left 993521939 5:88913729-88913751 CCTCTTTGGAGTTCTATTGGACT No data
Right 993521940 5:88913755-88913777 TGTCTGAGTCAGTGCTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993521939 Original CRISPR AGTCCAATAGAACTCCAAAG AGG (reversed) Intergenic