ID: 993521941

View in Genome Browser
Species Human (GRCh38)
Location 5:88913756-88913778
Sequence GTCTGAGTCAGTGCTTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993521933_993521941 29 Left 993521933 5:88913704-88913726 CCCCCTCTTCTCAGTGTCAGGAA No data
Right 993521941 5:88913756-88913778 GTCTGAGTCAGTGCTTATGTGGG No data
993521936_993521941 26 Left 993521936 5:88913707-88913729 CCTCTTCTCAGTGTCAGGAAAAC No data
Right 993521941 5:88913756-88913778 GTCTGAGTCAGTGCTTATGTGGG No data
993521935_993521941 27 Left 993521935 5:88913706-88913728 CCCTCTTCTCAGTGTCAGGAAAA No data
Right 993521941 5:88913756-88913778 GTCTGAGTCAGTGCTTATGTGGG No data
993521934_993521941 28 Left 993521934 5:88913705-88913727 CCCCTCTTCTCAGTGTCAGGAAA No data
Right 993521941 5:88913756-88913778 GTCTGAGTCAGTGCTTATGTGGG No data
993521939_993521941 4 Left 993521939 5:88913729-88913751 CCTCTTTGGAGTTCTATTGGACT No data
Right 993521941 5:88913756-88913778 GTCTGAGTCAGTGCTTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993521941 Original CRISPR GTCTGAGTCAGTGCTTATGT GGG Intergenic
No off target data available for this crispr