ID: 993521942

View in Genome Browser
Species Human (GRCh38)
Location 5:88913763-88913785
Sequence TCAGTGCTTATGTGGGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993521939_993521942 11 Left 993521939 5:88913729-88913751 CCTCTTTGGAGTTCTATTGGACT No data
Right 993521942 5:88913763-88913785 TCAGTGCTTATGTGGGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993521942 Original CRISPR TCAGTGCTTATGTGGGTTGC TGG Intergenic
No off target data available for this crispr