ID: 993525999

View in Genome Browser
Species Human (GRCh38)
Location 5:88966423-88966445
Sequence ATGTGAGTGGTTCACTAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993525996_993525999 21 Left 993525996 5:88966379-88966401 CCATTATAGAAGTACGGCTGAAA No data
Right 993525999 5:88966423-88966445 ATGTGAGTGGTTCACTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993525999 Original CRISPR ATGTGAGTGGTTCACTAAAC AGG Intergenic
No off target data available for this crispr