ID: 993526149

View in Genome Browser
Species Human (GRCh38)
Location 5:88968130-88968152
Sequence CAGGCAAAAGACTCTATATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993526149_993526150 -9 Left 993526149 5:88968130-88968152 CCAGATATAGAGTCTTTTGCCTG No data
Right 993526150 5:88968144-88968166 TTTTGCCTGAAATTTCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993526149 Original CRISPR CAGGCAAAAGACTCTATATC TGG (reversed) Intergenic
No off target data available for this crispr