ID: 993530728

View in Genome Browser
Species Human (GRCh38)
Location 5:89021521-89021543
Sequence GATAATAATCCCCTTCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993530728_993530730 0 Left 993530728 5:89021521-89021543 CCAGAAGGAAGGGGATTATTATC No data
Right 993530730 5:89021544-89021566 ACTCTTTGAGCCTATGGATGAGG No data
993530728_993530729 -6 Left 993530728 5:89021521-89021543 CCAGAAGGAAGGGGATTATTATC No data
Right 993530729 5:89021538-89021560 ATTATCACTCTTTGAGCCTATGG No data
993530728_993530731 1 Left 993530728 5:89021521-89021543 CCAGAAGGAAGGGGATTATTATC No data
Right 993530731 5:89021545-89021567 CTCTTTGAGCCTATGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993530728 Original CRISPR GATAATAATCCCCTTCCTTC TGG (reversed) Intergenic
No off target data available for this crispr