ID: 993530884

View in Genome Browser
Species Human (GRCh38)
Location 5:89024004-89024026
Sequence ATGTGTTAATGAGCTATAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993530884_993530887 -10 Left 993530884 5:89024004-89024026 CCCCTTATAGCTCATTAACACAT No data
Right 993530887 5:89024017-89024039 ATTAACACATAGAAAAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993530884 Original CRISPR ATGTGTTAATGAGCTATAAG GGG (reversed) Intergenic
No off target data available for this crispr