ID: 993532440

View in Genome Browser
Species Human (GRCh38)
Location 5:89041138-89041160
Sequence CTTAGGCATTTATACTTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993532435_993532440 9 Left 993532435 5:89041106-89041128 CCTTTGATGGGACAGTTCCTTCC No data
Right 993532440 5:89041138-89041160 CTTAGGCATTTATACTTGTAAGG No data
993532437_993532440 -8 Left 993532437 5:89041123-89041145 CCTTCCAGTCTCCATCTTAGGCA No data
Right 993532440 5:89041138-89041160 CTTAGGCATTTATACTTGTAAGG No data
993532434_993532440 10 Left 993532434 5:89041105-89041127 CCCTTTGATGGGACAGTTCCTTC No data
Right 993532440 5:89041138-89041160 CTTAGGCATTTATACTTGTAAGG No data
993532432_993532440 21 Left 993532432 5:89041094-89041116 CCATGAACGCTCCCTTTGATGGG No data
Right 993532440 5:89041138-89041160 CTTAGGCATTTATACTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993532440 Original CRISPR CTTAGGCATTTATACTTGTA AGG Intergenic
No off target data available for this crispr