ID: 993536072

View in Genome Browser
Species Human (GRCh38)
Location 5:89087907-89087929
Sequence GCATAATCCTGGCCTCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993536070_993536072 -9 Left 993536070 5:89087893-89087915 CCTTAATCTTCTTAGCATAATCC No data
Right 993536072 5:89087907-89087929 GCATAATCCTGGCCTCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993536072 Original CRISPR GCATAATCCTGGCCTCAAAG TGG Intergenic
No off target data available for this crispr