ID: 993552889

View in Genome Browser
Species Human (GRCh38)
Location 5:89296670-89296692
Sequence GTAGACATCCTGACATCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993552887_993552889 12 Left 993552887 5:89296635-89296657 CCTACAATTGATACTCTGATGAA No data
Right 993552889 5:89296670-89296692 GTAGACATCCTGACATCTGGAGG No data
993552886_993552889 18 Left 993552886 5:89296629-89296651 CCAAAACCTACAATTGATACTCT No data
Right 993552889 5:89296670-89296692 GTAGACATCCTGACATCTGGAGG No data
993552885_993552889 19 Left 993552885 5:89296628-89296650 CCCAAAACCTACAATTGATACTC No data
Right 993552889 5:89296670-89296692 GTAGACATCCTGACATCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993552889 Original CRISPR GTAGACATCCTGACATCTGG AGG Intergenic
No off target data available for this crispr