ID: 993556943

View in Genome Browser
Species Human (GRCh38)
Location 5:89351507-89351529
Sequence ATGGTGTTAGTAATCAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993556938_993556943 -4 Left 993556938 5:89351488-89351510 CCCATGTTTGCCAAATTCCATGG No data
Right 993556943 5:89351507-89351529 ATGGTGTTAGTAATCAAACATGG No data
993556937_993556943 4 Left 993556937 5:89351480-89351502 CCTAGATTCCCATGTTTGCCAAA No data
Right 993556943 5:89351507-89351529 ATGGTGTTAGTAATCAAACATGG No data
993556940_993556943 -5 Left 993556940 5:89351489-89351511 CCATGTTTGCCAAATTCCATGGT No data
Right 993556943 5:89351507-89351529 ATGGTGTTAGTAATCAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993556943 Original CRISPR ATGGTGTTAGTAATCAAACA TGG Intergenic
No off target data available for this crispr