ID: 993560554

View in Genome Browser
Species Human (GRCh38)
Location 5:89402021-89402043
Sequence TGAATTTGATCATTACTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993560551_993560554 16 Left 993560551 5:89401982-89402004 CCACTTTTAAACTGAGATGATGT No data
Right 993560554 5:89402021-89402043 TGAATTTGATCATTACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993560554 Original CRISPR TGAATTTGATCATTACTCTG AGG Intergenic
No off target data available for this crispr