ID: 993561332

View in Genome Browser
Species Human (GRCh38)
Location 5:89414479-89414501
Sequence AATCATATAACACTAACATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993561332_993561340 18 Left 993561332 5:89414479-89414501 CCTTATGTTAGTGTTATATGATT No data
Right 993561340 5:89414520-89414542 AACCTTTGGCTACTAATGATTGG No data
993561332_993561342 26 Left 993561332 5:89414479-89414501 CCTTATGTTAGTGTTATATGATT No data
Right 993561342 5:89414528-89414550 GCTACTAATGATTGGTTGTGTGG No data
993561332_993561334 4 Left 993561332 5:89414479-89414501 CCTTATGTTAGTGTTATATGATT No data
Right 993561334 5:89414506-89414528 CCCCCAATCTACCCAACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993561332 Original CRISPR AATCATATAACACTAACATA AGG (reversed) Intergenic
No off target data available for this crispr