ID: 993561333

View in Genome Browser
Species Human (GRCh38)
Location 5:89414506-89414528
Sequence CCAAAGGTTGGGTAGATTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993561333_993561342 -1 Left 993561333 5:89414506-89414528 CCCCCAATCTACCCAACCTTTGG No data
Right 993561342 5:89414528-89414550 GCTACTAATGATTGGTTGTGTGG No data
993561333_993561340 -9 Left 993561333 5:89414506-89414528 CCCCCAATCTACCCAACCTTTGG No data
Right 993561340 5:89414520-89414542 AACCTTTGGCTACTAATGATTGG No data
993561333_993561343 16 Left 993561333 5:89414506-89414528 CCCCCAATCTACCCAACCTTTGG No data
Right 993561343 5:89414545-89414567 GTGTGGTAGACCCTTAACTTTGG No data
993561333_993561344 17 Left 993561333 5:89414506-89414528 CCCCCAATCTACCCAACCTTTGG No data
Right 993561344 5:89414546-89414568 TGTGGTAGACCCTTAACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993561333 Original CRISPR CCAAAGGTTGGGTAGATTGG GGG (reversed) Intergenic
No off target data available for this crispr